diff --git a/examples/bioinformatics/tel_search.py b/examples/bioinformatics/tel_search.py
index bfb9b87..42cecbe 100644
--- a/examples/bioinformatics/tel_search.py
+++ b/examples/bioinformatics/tel_search.py
@@ -11,7 +11,7 @@
 import functools
 import multiprocessing
 
-import pandas, pandera
+import pandas
 
 import funix
 
@@ -127,10 +127,6 @@ def test():
     return search_telomeres(sRNAs, repeat)
 
 
-class InputSchema(pandera.DataFrameModel):
-    sRNAs: pandera.typing.Series[str]
-
-
 @funix.funix(
     description = "A telomere is a region of repetitive DNA sequences at the end of a chromosome. Enter a repeating unit, and a list of sRNAs in the table below, this telomere checker will tell whether each of the sRNAs is a telomere.",
     # destination = "column",
@@ -152,7 +148,7 @@ def telomere_check(
     #     "CCCTAAACCCTAAACCCTAAAC",  # True, 22-nt
     #     "CTAAACCCTAAACCCTAAACCCT"  # True, 25-nt
     # ],    
-    sRNAs: pandera.typing.DataFrame[InputSchema] =
+    sRNAs: pandas.DataFrame =
         pandas.DataFrame({"sRNAs": 
         [
             "CCCTAAACCCTAAACCCTAT",  # False
diff --git a/examples/bioinformatics/vector_strip.py b/examples/bioinformatics/vector_strip.py
index 4b1a004..5ae623b 100644
--- a/examples/bioinformatics/vector_strip.py
+++ b/examples/bioinformatics/vector_strip.py
@@ -6,7 +6,7 @@
 import functools
 import multiprocessing
 
-import pandas, pandera
+import pandas
 
 import funix
 
@@ -95,14 +95,6 @@ def test():
         print(code, ":", seq)
 
 
-class InputSchema(pandera.DataFrameModel):
-    sRNAs: pandera.typing.Series[str]
-
-
-class OutputSchema(pandera.DataFrameModel):
-    original_sRNA: pandera.typing.Series[str]
-    adapter_removed: pandera.typing.Series[str]
-
 
 @funix.funix(
     description="Remove 3' prime adapter from the end of an RNA-seq",
@@ -111,7 +103,7 @@ def remove_3_prime_adapter(
     # adapter_3_prime: str="TCGTATGCCGTCTTCTGCTT",
     adapter_3_prime: str = "TCGTA",
     minimal_match_length: int = 8,
-    sRNAs: pandera.typing.DataFrame[InputSchema] = pandas.DataFrame(
+    sRNAs: pandas.DataFrame = pandas.DataFrame(
         {
             "sRNAs": [
                 "AAGCTCAGGAGGGATAGCGCCTCGTATGCCGTCTTCTGC",  # shorter than full 3' adapter