From d371c3d4447796fc8f3e37f202009636fa0865f0 Mon Sep 17 00:00:00 2001
From: gagolews <m.gagolewski@gmail.com>
Date: Sat, 17 Sep 2022 17:13:58 +1000
Subject: [PATCH] v1.1.2

---
 .devel/sphinx/news.md                   |   4 +-
 .github/workflows/py.yml                |   4 +-
 DESCRIPTION                             |   2 +-
 NEWS                                    |   4 +-
 docs/_static/documentation_options.js   |   2 +-
 docs/genieclust.html                    |   4 +-
 docs/genieclust_cluster_validity.html   |   4 +-
 docs/genieclust_compare_partitions.html |  26 ++++-----
 docs/genieclust_genie.html              |   4 +-
 docs/genieclust_inequity.html           |   4 +-
 docs/genieclust_internal.html           |   4 +-
 docs/genieclust_plots-1.pdf             | Bin 8343 -> 8343 bytes
 docs/genieclust_plots-2.pdf             | Bin 12353 -> 12353 bytes
 docs/genieclust_plots-3.pdf             | Bin 7203 -> 7203 bytes
 docs/genieclust_plots-4.pdf             | Bin 8867 -> 8867 bytes
 docs/genieclust_plots.html              |   4 +-
 docs/genieclust_tools.html              |   4 +-
 docs/genindex.html                      |   4 +-
 docs/index.html                         |   4 +-
 docs/news.html                          |  67 ++++++++++++++----------
 docs/py-modindex.html                   |   4 +-
 docs/rapi.html                          |   4 +-
 docs/rapi/cluster_validity.html         |   4 +-
 docs/rapi/compare_partitions.html       |  10 ++--
 docs/rapi/emst_mlpack.html              |   4 +-
 docs/rapi/gclust.html                   |   4 +-
 docs/rapi/genieclust-package.html       |   4 +-
 docs/rapi/inequity.html                 |   4 +-
 docs/rapi/mst.html                      |   4 +-
 docs/search.html                        |   4 +-
 docs/searchindex.js                     |   2 +-
 docs/weave/basics.html                  |   4 +-
 docs/weave/benchmarks_approx.html       |   4 +-
 docs/weave/benchmarks_ar.html           |   4 +-
 docs/weave/benchmarks_details.html      |   4 +-
 docs/weave/noise.html                   |   4 +-
 docs/weave/r.html                       |   4 +-
 docs/weave/sklearn_toy_example.html     |   4 +-
 docs/weave/sparse.html                  |   4 +-
 docs/weave/string.html                  |   4 +-
 docs/weave/timings.html                 |   4 +-
 docs/z_bibliography.html                |   4 +-
 genieclust/__init__.py                  |   2 +-
 43 files changed, 123 insertions(+), 116 deletions(-)

diff --git a/.devel/sphinx/news.md b/.devel/sphinx/news.md
index 0419e5b9..684c3bb0 100644
--- a/.devel/sphinx/news.md
+++ b/.devel/sphinx/news.md
@@ -1,7 +1,7 @@
 # What Is New in *genieclust*
 
 
-## 1.1.1.9001 (under development)
+## 1.1.2 (2022-09-17)
 
 *  [Python and R] `adjusted_asymmetric_accuracy`
    now accepts confusion matrices with fewer columns than rows.
@@ -10,8 +10,6 @@
 *  [Python and R] `pair_sets_index`, and `normalized_accuracy` return
    the same results for nonsymmetric confusion matrices and transposes thereof.
 
-*  ...
-
 
 ## 1.1.1 (2022-09-15)
 
diff --git a/.github/workflows/py.yml b/.github/workflows/py.yml
index 942fd1eb..2ee23a45 100644
--- a/.github/workflows/py.yml
+++ b/.github/workflows/py.yml
@@ -47,6 +47,6 @@ jobs:
     - name: Lint with flake8
       run: |
         # stop the build if there are Python syntax errors or undefined names
-        flake8 . --count --select=E9,F63,F7,F82 --show-source --statistics  --exclude=devel,build,docs,.git,R,dist,genieclust.egg-info,man,tutorials
+        flake8 . --count --select=E9,F63,F7,F82 --show-source --statistics  --exclude=.devel,build,docs,.git,R,dist,genieclust.egg-info,man,tutorials
         # exit-zero treats all errors as warnings
-        flake8 . --count --exit-zero --max-complexity=10 --max-line-length=127 --statistics  --exclude=devel,build,docs,.git,R,dist,genieclust.egg-info,man,tutorials
+        flake8 . --count --exit-zero --max-complexity=10 --max-line-length=127 --statistics  --exclude=.devel,build,docs,.git,R,dist,genieclust.egg-info,man,tutorials
diff --git a/DESCRIPTION b/DESCRIPTION
index c5acc2a3..3a7ec0a6 100644
--- a/DESCRIPTION
+++ b/DESCRIPTION
@@ -1,7 +1,7 @@
 Package: genieclust
 Type: Package
 Title: Fast and Robust Hierarchical Clustering with Noise Points Detection
-Version: 1.1.1.9001
+Version: 1.1.2
 Date: 2022-09-17
 Authors@R: c(
     person("Marek", "Gagolewski",
diff --git a/NEWS b/NEWS
index 0419e5b9..684c3bb0 100644
--- a/NEWS
+++ b/NEWS
@@ -1,7 +1,7 @@
 # What Is New in *genieclust*
 
 
-## 1.1.1.9001 (under development)
+## 1.1.2 (2022-09-17)
 
 *  [Python and R] `adjusted_asymmetric_accuracy`
    now accepts confusion matrices with fewer columns than rows.
@@ -10,8 +10,6 @@
 *  [Python and R] `pair_sets_index`, and `normalized_accuracy` return
    the same results for nonsymmetric confusion matrices and transposes thereof.
 
-*  ...
-
 
 ## 1.1.1 (2022-09-15)
 
diff --git a/docs/_static/documentation_options.js b/docs/_static/documentation_options.js
index 2c5b67a6..ad675b93 100644
--- a/docs/_static/documentation_options.js
+++ b/docs/_static/documentation_options.js
@@ -1,6 +1,6 @@
 var DOCUMENTATION_OPTIONS = {
     URL_ROOT: document.getElementById("documentation_options").getAttribute('data-url_root'),
-    VERSION: '1.1.1',
+    VERSION: '1.1.2',
     LANGUAGE: 'en',
     COLLAPSE_INDEX: false,
     BUILDER: 'html',
diff --git a/docs/genieclust.html b/docs/genieclust.html
index f37a665c..cd62bb66 100644
--- a/docs/genieclust.html
+++ b/docs/genieclust.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -303,7 +303,7 @@ <h1>Python Package <cite>genieclust</cite> Reference<a class="headerlink" href="
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/genieclust_cluster_validity.html b/docs/genieclust_cluster_validity.html
index 777fce25..5ba08219 100644
--- a/docs/genieclust_cluster_validity.html
+++ b/docs/genieclust_cluster_validity.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -901,7 +901,7 @@
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/genieclust_compare_partitions.html b/docs/genieclust_compare_partitions.html
index e961a6d2..26715e68 100644
--- a/docs/genieclust_compare_partitions.html
+++ b/docs/genieclust_compare_partitions.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -283,13 +283,14 @@
 </div>
 <p class="rubric">Notes</p>
 <p>Let <span class="math notranslate nohighlight">\(C\)</span> be a confusion matrix with <span class="math notranslate nohighlight">\(K\)</span> rows
-and <span class="math notranslate nohighlight">\(K\)</span> columns.
+and <span class="math notranslate nohighlight">\(L\)</span> columns.
 AAA is an external cluster validity measure.
 It is a corrected-for-chance summary of the proportion of correctly
 classified points in each cluster (with cluster matching based on the
 solution to the maximal linear sum assignment problem; see
 <a class="reference internal" href="#genieclust.compare_partitions.normalize_confusion_matrix" title="genieclust.compare_partitions.normalize_confusion_matrix"><code class="xref py py-func docutils literal notranslate"><span class="pre">normalize_confusion_matrix()</span></code></a>), given by:
-<span class="math notranslate nohighlight">\((\max_\sigma \sum_{i=1}^K (c_{i, \sigma(i)}/(c_{i, 1}+...+c_{i, K})) - 1)/(K - 1)\)</span>.</p>
+<span class="math notranslate nohighlight">\((\max_\sigma \sum_{i=1}^K (c_{i, \sigma(i)}/(c_{i, 1}+...+c_{i, K})) - 1)/(K - 1)\)</span>.
+Missing columns are treated as if they were filled with 0s.</p>
 <p>Note that this measure is not symmetric, i.e., <code class="docutils literal notranslate"><span class="pre">index(x,</span> <span class="pre">y)</span></code> does not
 have to be equal to <code class="docutils literal notranslate"><span class="pre">index(y,</span> <span class="pre">x)</span></code>.</p>
 <p>See <a class="reference internal" href="#r4f44c4f81b3c-1" id="id2">[1]</a> for more details and <a class="reference internal" href="#genieclust.compare_partitions.compare_partitions" title="genieclust.compare_partitions.compare_partitions"><code class="xref py py-func docutils literal notranslate"><span class="pre">compare_partitions()</span></code></a> for more functions.</p>
@@ -407,7 +408,7 @@
 <dt class="field-odd">Parameters</dt>
 <dd class="field-odd"><dl class="simple">
 <dt><strong>C</strong><span class="classifier">ndarray</span></dt><dd><p>A <code class="docutils literal notranslate"><span class="pre">c_contiguous</span></code> confusion matrix (contingency table)
-with <span class="math notranslate nohighlight">\(K\)</span> rows and <span class="math notranslate nohighlight">\(L\)</span> columns, where <span class="math notranslate nohighlight">\(K \le L\)</span>.</p>
+with <span class="math notranslate nohighlight">\(K\)</span> rows and <span class="math notranslate nohighlight">\(L\)</span> columns.</p>
 </dd>
 </dl>
 </dd>
@@ -435,7 +436,7 @@
 </dd>
 <dt><code class="docutils literal notranslate"><span class="pre">'spsi'</span></code></dt><dd><p>Simplified pair sets index</p>
 </dd>
-<dt><code class="docutils literal notranslate"><span class="pre">'aaa'</span></code></dt><dd><p>Adjusted asymmetric accuracy (or <code class="docutils literal notranslate"><span class="pre">nan</span></code> if <span class="math notranslate nohighlight">\(K \neq L\)</span>);
+<dt><code class="docutils literal notranslate"><span class="pre">'aaa'</span></code></dt><dd><p>Adjusted asymmetric accuracy;
 it is assumed that rows in <cite>C</cite> represent the ground-truth
 partition</p>
 </dd>
@@ -471,8 +472,8 @@
 nonempty and pairwise disjoint subsets.
 For instance, these can be two clusterings of a dataset with <span class="math notranslate nohighlight">\(n\)</span>
 observations specified as vectors of labels. Moreover, let <cite>C</cite> be the
-confusion matrix (with <span class="math notranslate nohighlight">\(K\)</span> rows and <span class="math notranslate nohighlight">\(L\)</span> columns,
-<span class="math notranslate nohighlight">\(K \leq L\)</span>) corresponding to <cite>x</cite> and <cite>y</cite>; see also
+confusion matrix with <span class="math notranslate nohighlight">\(K\)</span> rows and <span class="math notranslate nohighlight">\(L\)</span> columns,
+corresponding to <cite>x</cite> and <cite>y</cite>; see also
 <a class="reference internal" href="#genieclust.compare_partitions.confusion_matrix" title="genieclust.compare_partitions.confusion_matrix"><code class="xref py py-func docutils literal notranslate"><span class="pre">confusion_matrix()</span></code></a>.</p>
 <p>This function implements a few scores that aim to quantify
 the similarity between <cite>x</cite> and <cite>y</cite>.</p>
@@ -487,8 +488,7 @@
 Note that partitions are always defined up to a bijection of the set of
 possible labels, e.g., (1, 1, 2, 1) and (4, 4, 2, 4)
 represent the same 2-partition.</p>
-<p><cite>adjusted_asymmetric_accuracy</cite> <a class="reference internal" href="#rb28289ab3e3a-2" id="id5">[2]</a>
-only accepts <span class="math notranslate nohighlight">\(K = L\)</span>. It is an external cluster validity measure
+<p><cite>adjusted_asymmetric_accuracy</cite> <a class="reference internal" href="#rb28289ab3e3a-2" id="id5">[2]</a> is an external cluster validity measure
 which assumes that the label vector <cite>x</cite> (or rows in the confusion
 matrix) represents the reference (ground truth) partition.
 It is a corrected-for-chance summary of the proportion of correctly
@@ -498,15 +498,15 @@
 <span class="math notranslate nohighlight">\((\max_\sigma \sum_{i=1}^K (c_{i, \sigma(i)}/(c_{i, 1}+...+c_{i, K})) - 1)/(K - 1)\)</span>,
 where <span class="math notranslate nohighlight">\(C\)</span> is the confusion matrix.</p>
 <p><cite>normalized_accuracy</cite> is a measure defined as
-<span class="math notranslate nohighlight">\((\mathrm{Accuracy}(C_\sigma)-1/L)/(1-1/L)\)</span>,
+<span class="math notranslate nohighlight">\((\mathrm{Accuracy}(C_\sigma)-1/\max(K,L))/(1-1/\max(K,L))\)</span>,
 where <span class="math notranslate nohighlight">\(C_\sigma\)</span> is a version of the confusion matrix
-for given <cite>x</cite> and <cite>y</cite>, <span class="math notranslate nohighlight">\(K \leq L\)</span>, with columns permuted
+for given <cite>x</cite> and <cite>y</cite> with columns permuted
 based on the solution to the maximal linear sum assignment problem.
 Note that the <span class="math notranslate nohighlight">\(\mathrm{Accuracy}(C_\sigma)\)</span> part
 is sometimes referred to as set-matching classification
 rate or pivoted accuracy.</p>
 <p><cite>pair_sets_index</cite> gives the Pair Sets Index (PSI)
-adjusted for chance <a class="reference internal" href="#rb28289ab3e3a-3" id="id6">[3]</a>, <span class="math notranslate nohighlight">\(K \leq L\)</span>.
+adjusted for chance <a class="reference internal" href="#rb28289ab3e3a-3" id="id6">[3]</a>.
 Pairing is based on the solution to the linear sum assignment problem
 of a transformed version of the confusion matrix.
 Its simplified version assumes E=1 in the definition of the index,
@@ -1026,7 +1026,7 @@
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/genieclust_genie.html b/docs/genieclust_genie.html
index 83d97325..812a9548 100644
--- a/docs/genieclust_genie.html
+++ b/docs/genieclust_genie.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -651,7 +651,7 @@ <h1>genieclust.Genie<a class="headerlink" href="#genieclust-genie" title="Permal
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/genieclust_inequity.html b/docs/genieclust_inequity.html
index 57ba6439..c4174894 100644
--- a/docs/genieclust_inequity.html
+++ b/docs/genieclust_inequity.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -486,7 +486,7 @@
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/genieclust_internal.html b/docs/genieclust_internal.html
index 069e8b31..9599bd7b 100644
--- a/docs/genieclust_internal.html
+++ b/docs/genieclust_internal.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -580,7 +580,7 @@
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/genieclust_plots-1.pdf b/docs/genieclust_plots-1.pdf
index 0021cdf7fe7040d83e6c40ee145829307e9af0b9..48b09a1ceb53042b79ddd3ebb0854e47266dbb69 100644
GIT binary patch
delta 20
ccmbR4INfo>aaneALvur8L&MGIWKS{y08N1h8UO$Q

delta 20
ccmbR4INfo>aand#Lt`UjLyOJlWKS{y08MlU8~^|S

diff --git a/docs/genieclust_plots-2.pdf b/docs/genieclust_plots-2.pdf
index 08bdf029cca5bdf4e285a491703d6ede0f501444..2b0293da702c4192c9e4bde1d56a9613c5bc20d7 100644
GIT binary patch
delta 20
bcmX?@a4=!R18sJ5Lvur8L&MF_wWC-7S_TJ=

delta 20
bcmX?@a4=!R18sIwLt`UjLyOJNwWC-7S@{Q#

diff --git a/docs/genieclust_plots-3.pdf b/docs/genieclust_plots-3.pdf
index 5d52de1fe8d69e70f2a563d63eacbfe32c27e1e0..20894787d5d1766f745fe74f43c0ff3934aae02a 100644
GIT binary patch
delta 20
bcmZ2%vDjimwIsW_p}C>4q2cBx$%RY+N6iLU

delta 20
bcmZ2%vDjimwIsW#p|O#%q2=Z#$%RY+N5%$Q

diff --git a/docs/genieclust_plots-4.pdf b/docs/genieclust_plots-4.pdf
index ac7daafff4da703ac1dc3e42020c798113764cb5..519d7091ea9faa8c4cd16642d466b792df619b56 100644
GIT binary patch
delta 20
ccmZ4Ny4ZEYb9r`iLvur8L&MGQ<hL>b08%ptY5)KL

delta 20
ccmZ4Ny4ZEYb9r`CLt`UjL(9$Y<hL>b08%UmZ2$lO

diff --git a/docs/genieclust_plots.html b/docs/genieclust_plots.html
index c9362258..7c970369 100644
--- a/docs/genieclust_plots.html
+++ b/docs/genieclust_plots.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -397,7 +397,7 @@
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/genieclust_tools.html b/docs/genieclust_tools.html
index 860e876b..1574fba4 100644
--- a/docs/genieclust_tools.html
+++ b/docs/genieclust_tools.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -424,7 +424,7 @@
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/genindex.html b/docs/genindex.html
index 5fdee6b9..d739b532 100644
--- a/docs/genindex.html
+++ b/docs/genindex.html
@@ -75,7 +75,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -539,7 +539,7 @@ <h2 id="W">W</h2>
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/index.html b/docs/index.html
index 7da1f659..59bb1b56 100644
--- a/docs/index.html
+++ b/docs/index.html
@@ -77,7 +77,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -440,7 +440,7 @@ <h2>Contributing<a class="headerlink" href="#contributing" title="Permalink to t
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/news.html b/docs/news.html
index 7835de50..0cb10633 100644
--- a/docs/news.html
+++ b/docs/news.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -145,15 +145,16 @@
 <p class="caption" role="heading"><span class="caption-text">Appendix</span></p>
 <ul class="current">
 <li class="toctree-l1 current"><a class="current reference internal" href="#">What Is New in <em>genieclust</em></a><ul>
-<li class="toctree-l2"><a class="reference internal" href="#id1">1.1.1 (2022-09-15)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="#id2">1.1.0 (2022-09-05)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="#id3">1.0.1 (2022-08-08)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="#id4">1.0.0 (2021-04-22)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="#id5">0.9.8 (2021-01-08)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="#id6">0.9.4 (2020-07-31)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="#id7">0.9.3 (2020-07-25)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="#id8">0.9.2 (2020-07-22)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="#id9">0.9.1 (2020-07-18)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id1">1.1.2 (2022-09-17)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id2">1.1.1 (2022-09-15)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id3">1.1.0 (2022-09-05)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id4">1.0.1 (2022-08-08)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id5">1.0.0 (2021-04-22)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id6">0.9.8 (2021-01-08)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id7">0.9.4 (2020-07-31)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id8">0.9.3 (2020-07-25)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id9">0.9.2 (2020-07-22)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id10">0.9.1 (2020-07-18)</a></li>
 <li class="toctree-l2"><a class="reference internal" href="#a2-2018-05-23">0.1a2 (2018-05-23)</a></li>
 </ul>
 </li>
@@ -244,14 +245,24 @@
   <section class="tex2jax_ignore mathjax_ignore" id="what-is-new-in-genieclust">
 <h1>What Is New in <em>genieclust</em><a class="headerlink" href="#what-is-new-in-genieclust" title="Permalink to this heading"></a></h1>
 <section id="id1">
-<h2>1.1.1 (2022-09-15)<a class="headerlink" href="#id1" title="Permalink to this heading"></a></h2>
+<h2>1.1.2 (2022-09-17)<a class="headerlink" href="#id1" title="Permalink to this heading"></a></h2>
+<ul class="simple">
+<li><p>[Python and R] <code class="docutils literal notranslate"><span class="pre">adjusted_asymmetric_accuracy</span></code>
+now accepts confusion matrices with fewer columns than rows.
+Such “missing” columns are now treated as if they were filled with 0s.</p></li>
+<li><p>[Python and R] <code class="docutils literal notranslate"><span class="pre">pair_sets_index</span></code>, and <code class="docutils literal notranslate"><span class="pre">normalized_accuracy</span></code> return
+the same results for nonsymmetric confusion matrices and transposes thereof.</p></li>
+</ul>
+</section>
+<section id="id2">
+<h2>1.1.1 (2022-09-15)<a class="headerlink" href="#id2" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>[Python] #75: <code class="docutils literal notranslate"><span class="pre">nmslib</span></code> is now optional.</p></li>
 <li><p>[BUILD TIME]: The use of <code class="docutils literal notranslate"><span class="pre">ssize_t</span></code> was not portable.</p></li>
 </ul>
 </section>
-<section id="id2">
-<h2>1.1.0 (2022-09-05)<a class="headerlink" href="#id2" title="Permalink to this heading"></a></h2>
+<section id="id3">
+<h2>1.1.0 (2022-09-05)<a class="headerlink" href="#id3" title="Permalink to this heading"></a></h2>
 <ul>
 <li><p>[GENERAL] The below-mentioned cluster validity measures are discussed
 in more detail at <a class="reference external" href="https://clustering-benchmarks.gagolewski.com">https://clustering-benchmarks.gagolewski.com</a>.</p></li>
@@ -285,8 +296,8 @@ <h2>1.1.0 (2022-09-05)<a class="headerlink" href="#id2" title="Permalink to this
 <code class="docutils literal notranslate"><span class="pre">axis</span></code>, <code class="docutils literal notranslate"><span class="pre">title</span></code>, <code class="docutils literal notranslate"><span class="pre">xlabel</span></code>, <code class="docutils literal notranslate"><span class="pre">ylabel</span></code>, <code class="docutils literal notranslate"><span class="pre">xlim</span></code>, <code class="docutils literal notranslate"><span class="pre">ylim</span></code>.</p></li>
 </ul>
 </section>
-<section id="id3">
-<h2>1.0.1 (2022-08-08)<a class="headerlink" href="#id3" title="Permalink to this heading"></a></h2>
+<section id="id4">
+<h2>1.0.1 (2022-08-08)<a class="headerlink" href="#id4" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>[GENERAL] A paper on the <code class="docutils literal notranslate"><span class="pre">genieclust</span></code> package is now available:
 M. Gagolewski, genieclust: Fast and robust hierarchical clustering,
@@ -298,15 +309,15 @@ <h2>1.0.1 (2022-08-08)<a class="headerlink" href="#id3" title="Permalink to this
 <li><p>[R] New function: <code class="docutils literal notranslate"><span class="pre">devergottini_index</span></code>.</p></li>
 </ul>
 </section>
-<section id="id4">
-<h2>1.0.0 (2021-04-22)<a class="headerlink" href="#id4" title="Permalink to this heading"></a></h2>
+<section id="id5">
+<h2>1.0.0 (2021-04-22)<a class="headerlink" href="#id5" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>[R] Use <code class="docutils literal notranslate"><span class="pre">mlpack</span></code> instead of <code class="docutils literal notranslate"><span class="pre">RcppMLPACK</span></code> (#72).
 This package is merely suggested, not dependent upon.</p></li>
 </ul>
 </section>
-<section id="id5">
-<h2>0.9.8 (2021-01-08)<a class="headerlink" href="#id5" title="Permalink to this heading"></a></h2>
+<section id="id6">
+<h2>0.9.8 (2021-01-08)<a class="headerlink" href="#id6" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>[Python] Require Python &gt;= 3.7 (implied by <code class="docutils literal notranslate"><span class="pre">numpy</span></code>).</p></li>
 <li><p>[Python] Require <code class="docutils literal notranslate"><span class="pre">nmslib</span></code>.</p></li>
@@ -314,28 +325,28 @@ <h2>0.9.8 (2021-01-08)<a class="headerlink" href="#id5" title="Permalink to this
 <li><p>[R] Use <code class="docutils literal notranslate"><span class="pre">tinytest</span></code> for unit testing instead of <code class="docutils literal notranslate"><span class="pre">testthat</span></code>.</p></li>
 </ul>
 </section>
-<section id="id6">
-<h2>0.9.4 (2020-07-31)<a class="headerlink" href="#id6" title="Permalink to this heading"></a></h2>
+<section id="id7">
+<h2>0.9.4 (2020-07-31)<a class="headerlink" href="#id7" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>[BUGFIX] [R] Fix build errors on Solaris.</p></li>
 </ul>
 </section>
-<section id="id7">
-<h2>0.9.3 (2020-07-25)<a class="headerlink" href="#id7" title="Permalink to this heading"></a></h2>
+<section id="id8">
+<h2>0.9.3 (2020-07-25)<a class="headerlink" href="#id8" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>[BUGFIX] [Python] Add code coverage CI. Fix some minor inconsistencies.
 Automate the <code class="docutils literal notranslate"><span class="pre">bdist</span></code> build chain.</p></li>
 <li><p>[R] Update DESCRIPTION to meet the CRAN policies.</p></li>
 </ul>
 </section>
-<section id="id8">
-<h2>0.9.2 (2020-07-22)<a class="headerlink" href="#id8" title="Permalink to this heading"></a></h2>
+<section id="id9">
+<h2>0.9.2 (2020-07-22)<a class="headerlink" href="#id9" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>[BUGFIX] [Python] Fix broken build script for OS X with no OpenMP.</p></li>
 </ul>
 </section>
-<section id="id9">
-<h2>0.9.1 (2020-07-18)<a class="headerlink" href="#id9" title="Permalink to this heading"></a></h2>
+<section id="id10">
+<h2>0.9.1 (2020-07-18)<a class="headerlink" href="#id10" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>[GENERAL] The package has been completely rewritten.
 The core functionality is now implemented in C++ (with OpenMP).</p></li>
@@ -379,7 +390,7 @@ <h2>0.1a2 (2018-05-23)<a class="headerlink" href="#a2-2018-05-23" title="Permali
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/py-modindex.html b/docs/py-modindex.html
index d5c363d3..db300338 100644
--- a/docs/py-modindex.html
+++ b/docs/py-modindex.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -285,7 +285,7 @@ <h1>Python Module Index</h1>
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/rapi.html b/docs/rapi.html
index 8de0d14f..46c58fe8 100644
--- a/docs/rapi.html
+++ b/docs/rapi.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -273,7 +273,7 @@ <h1>R Package <em>genieclust</em> Reference<a class="headerlink" href="#r-packag
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/rapi/cluster_validity.html b/docs/rapi/cluster_validity.html
index 3c94eed6..7bfcaf6d 100644
--- a/docs/rapi/cluster_validity.html
+++ b/docs/rapi/cluster_validity.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -375,7 +375,7 @@ <h2>Examples<a class="headerlink" href="#examples" title="Permalink to this head
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/rapi/compare_partitions.html b/docs/rapi/compare_partitions.html
index 20ea2144..1a04cf96 100644
--- a/docs/rapi/compare_partitions.html
+++ b/docs/rapi/compare_partitions.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -313,9 +313,9 @@ <h2>Arguments<a class="headerlink" href="#arguments" title="Permalink to this he
 <h2>Details<a class="headerlink" href="#details" title="Permalink to this heading"></a></h2>
 <p>Each index except <code class="docutils literal notranslate"><span class="pre">adjusted_asymmetric_accuracy()</span></code> can act as a pairwise partition similarity score: it is symmetric, i.e., <code class="docutils literal notranslate"><span class="pre">index(x,</span> <span class="pre">y)</span> <span class="pre">==</span> <span class="pre">index(y,</span> <span class="pre">x)</span></code>.</p>
 <p>Each index except <code class="docutils literal notranslate"><span class="pre">mi_score()</span></code> (which computes the mutual information score) outputs 1 given two identical partitions. Note that partitions are always defined up to a bijection of the set of possible labels, e.g., (1, 1, 2, 1) and (4, 4, 2, 4) represent the same 2-partition.</p>
-<p><code class="docutils literal notranslate"><span class="pre">adjusted_asymmetric_accuracy()</span></code> (Gagolewski, 2022) only accepts <span class="math notranslate nohighlight">\(K = L\)</span>. It is an external cluster validity measure which assumes that the label vector <code class="docutils literal notranslate"><span class="pre">x</span></code> (or rows in the confusion matrix) represents the reference (ground truth) partition. It is a corrected-for-chance summary of the proportion of correctly classified points in each cluster (with cluster matching based on the solution to the maximal linear sum assignment problem; see <a class="reference internal" href="#"><span class="doc std std-doc"><code class="docutils literal notranslate"><span class="pre">normalized_confusion_matrix</span></code></span></a>), given by: <span class="math notranslate nohighlight">\((\max_\sigma \sum_{i=1}^K (c_{i, \sigma(i)}/(c_{i, 1}+...+c_{i, K})) - 1)/(K - 1)\)</span>, where <span class="math notranslate nohighlight">\(C\)</span> is the confusion matrix.</p>
-<p><code class="docutils literal notranslate"><span class="pre">normalized_accuracy()</span></code> is defined as <span class="math notranslate nohighlight">\((Accuracy(C_\sigma)-1/L)/(1-1/L)\)</span>, where <span class="math notranslate nohighlight">\(C_\sigma\)</span> is a version of the confusion matrix for given <code class="docutils literal notranslate"><span class="pre">x</span></code> and <code class="docutils literal notranslate"><span class="pre">y</span></code>, <span class="math notranslate nohighlight">\(K \leq L\)</span>, with columns permuted based on the solution to the maximal linear sum assignment problem. The <span class="math notranslate nohighlight">\(Accuracy(C_\sigma)\)</span> part is sometimes referred to as set-matching classification rate or pivoted accuracy.</p>
-<p><code class="docutils literal notranslate"><span class="pre">pair_sets_index()</span></code> gives the Pair Sets Index (PSI) adjusted for chance (Rezaei, Franti, 2016), <span class="math notranslate nohighlight">\(K \leq L\)</span>. Pairing is based on the solution to the linear sum assignment problem of a transformed version of the confusion matrix. Its simplified version assumes E=1 in the definition of the index, i.e., uses Eq. (20) instead of (18).</p>
+<p><code class="docutils literal notranslate"><span class="pre">adjusted_asymmetric_accuracy()</span></code> (Gagolewski, 2022) is an external cluster validity measure which assumes that the label vector <code class="docutils literal notranslate"><span class="pre">x</span></code> (or rows in the confusion matrix) represents the reference (ground truth) partition. It is a corrected-for-chance summary of the proportion of correctly classified points in each cluster (with cluster matching based on the solution to the maximal linear sum assignment problem; see <a class="reference internal" href="#"><span class="doc std std-doc"><code class="docutils literal notranslate"><span class="pre">normalized_confusion_matrix</span></code></span></a>), given by: <span class="math notranslate nohighlight">\((\max_\sigma \sum_{i=1}^K (c_{i, \sigma(i)}/(c_{i, 1}+...+c_{i, K})) - 1)/(K - 1)\)</span>, where <span class="math notranslate nohighlight">\(C\)</span> is the confusion matrix.</p>
+<p><code class="docutils literal notranslate"><span class="pre">normalized_accuracy()</span></code> is defined as <span class="math notranslate nohighlight">\((Accuracy(C_\sigma)-1/max(K,L))/(1-1/max(K,L))\)</span>, where <span class="math notranslate nohighlight">\(C_\sigma\)</span> is a version of the confusion matrix for given <code class="docutils literal notranslate"><span class="pre">x</span></code> and <code class="docutils literal notranslate"><span class="pre">y</span></code> with columns permuted based on the solution to the maximal linear sum assignment problem. The <span class="math notranslate nohighlight">\(Accuracy(C_\sigma)\)</span> part is sometimes referred to as set-matching classification rate or pivoted accuracy.</p>
+<p><code class="docutils literal notranslate"><span class="pre">pair_sets_index()</span></code> gives the Pair Sets Index (PSI) adjusted for chance (Rezaei, Franti, 2016). Pairing is based on the solution to the linear sum assignment problem of a transformed version of the confusion matrix. Its simplified version assumes E=1 in the definition of the index, i.e., uses Eq. (20) instead of (18).</p>
 <p><code class="docutils literal notranslate"><span class="pre">rand_score()</span></code> gives the Rand score (the “probability” of agreement between the two partitions) and <code class="docutils literal notranslate"><span class="pre">adjusted_rand_score()</span></code> is its version corrected for chance, see (Hubert, Arabie, 1985), its expected value is 0.0 given two independent partitions. Due to the adjustment, the resulting index might also be negative for some inputs.</p>
 <p>Similarly, <code class="docutils literal notranslate"><span class="pre">fm_score()</span></code> gives the Fowlkes-Mallows (FM) score and <code class="docutils literal notranslate"><span class="pre">adjusted_fm_score()</span></code> is its adjusted-for-chance version, see (Hubert, Arabie, 1985).</p>
 <p>Note that both the (unadjusted) Rand and FM scores are bounded from below by <span class="math notranslate nohighlight">\(1/(K+1)\)</span> if <span class="math notranslate nohighlight">\(K=L\)</span>, hence their adjusted versions are preferred.</p>
@@ -405,7 +405,7 @@ <h2>Examples<a class="headerlink" href="#examples" title="Permalink to this head
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/rapi/emst_mlpack.html b/docs/rapi/emst_mlpack.html
index 100e2a61..a7861004 100644
--- a/docs/rapi/emst_mlpack.html
+++ b/docs/rapi/emst_mlpack.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -325,7 +325,7 @@ <h2>See Also<a class="headerlink" href="#see-also" title="Permalink to this head
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/rapi/gclust.html b/docs/rapi/gclust.html
index c48069b9..8add2b54 100644
--- a/docs/rapi/gclust.html
+++ b/docs/rapi/gclust.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -436,7 +436,7 @@ <h2>Examples<a class="headerlink" href="#examples" title="Permalink to this head
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/rapi/genieclust-package.html b/docs/rapi/genieclust-package.html
index 8be78ac8..29a84dab 100644
--- a/docs/rapi/genieclust-package.html
+++ b/docs/rapi/genieclust-package.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -282,7 +282,7 @@ <h2>See Also<a class="headerlink" href="#see-also" title="Permalink to this head
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/rapi/inequity.html b/docs/rapi/inequity.html
index f5a7f3fb..38df2d12 100644
--- a/docs/rapi/inequity.html
+++ b/docs/rapi/inequity.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -386,7 +386,7 @@ <h2>Examples<a class="headerlink" href="#examples" title="Permalink to this head
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/rapi/mst.html b/docs/rapi/mst.html
index 51ab864c..c1886e85 100644
--- a/docs/rapi/mst.html
+++ b/docs/rapi/mst.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -371,7 +371,7 @@ <h2>Examples<a class="headerlink" href="#examples" title="Permalink to this head
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/search.html b/docs/search.html
index 572b785a..195d380d 100644
--- a/docs/search.html
+++ b/docs/search.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -248,7 +248,7 @@
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/searchindex.js b/docs/searchindex.js
index 8937e9fc..e84deffa 100644
--- a/docs/searchindex.js
+++ b/docs/searchindex.js
@@ -1 +1 @@
-Search.setIndex({"docnames": ["genieclust", "genieclust_cluster_validity", "genieclust_compare_partitions", "genieclust_genie", "genieclust_inequity", "genieclust_internal", "genieclust_plots", "genieclust_tools", "index", "news", "rapi", "rapi/cluster_validity", "rapi/compare_partitions", "rapi/emst_mlpack", "rapi/gclust", "rapi/genieclust-package", "rapi/inequity", "rapi/mst", "weave/basics", "weave/benchmarks_approx", "weave/benchmarks_ar", "weave/benchmarks_details", "weave/noise", "weave/r", "weave/sklearn_toy_example", "weave/sparse", "weave/string", "weave/timings", "z_bibliography"], "filenames": ["genieclust.rst", "genieclust_cluster_validity.rst", "genieclust_compare_partitions.rst", "genieclust_genie.rst", "genieclust_inequity.rst", "genieclust_internal.rst", "genieclust_plots.rst", "genieclust_tools.rst", "index.md", "news.md", "rapi.md", "rapi/cluster_validity.md", "rapi/compare_partitions.md", "rapi/emst_mlpack.md", "rapi/gclust.md", "rapi/genieclust-package.md", "rapi/inequity.md", "rapi/mst.md", "weave/basics.rst", "weave/benchmarks_approx.rst", "weave/benchmarks_ar.rst", "weave/benchmarks_details.rst", "weave/noise.rst", "weave/r.md", "weave/sklearn_toy_example.rst", "weave/sparse.rst", "weave/string.rst", "weave/timings.rst", "z_bibliography.rst"], "titles": ["Python Package <cite>genieclust</cite> Reference", "genieclust.cluster_validity", "genieclust.compare_partitions", "genieclust.Genie", "genieclust.inequity", "genieclust.internal", "genieclust.plots", "genieclust.tools", "<em>genieclust</em>: Fast and Robust Hierarchical Clustering with Noise Point Detection", "What Is New in <em>genieclust</em>", "R Package <em>genieclust</em> Reference", "cluster_validity: Internal Cluster Validity Measures", "compare_partitions: External Cluster Validity Measures and Pairwise Partition Similarity Scores", "emst_mlpack: Euclidean Minimum Spanning Tree", "gclust: Hierarchical Clustering Algorithm Genie", "genieclust-package: The Genie Hierarchical Clustering Algorithm (with Extras)", "inequity: Inequity (Inequality) Measures", "mst: Minimum Spanning Tree of the Pairwise Distance Graph", "Basics", "Benchmarks \u2014 Approximate Method", "Benchmarks (How Good Is It?)", "Benchmarks \u2014 Detailed Results", "Clustering with Noise Points Detection", "R Interface Examples", "Comparing Algorithms on Toy Datasets", "Example: Sparse Data and Movie Recommendation", "Example: String Data and Grouping of DNA", "Timings (How Fast Is It?)", "References"], "terms": {"geni": [0, 4, 5, 8, 10, 16, 17, 18, 19, 20, 22, 23, 24, 25, 26, 27, 28], "cluster_valid": [0, 9, 10], "compare_partit": [0, 9, 10, 18, 21, 26], "inequ": [0, 3, 8, 9, 10, 18], "intern": [0, 1, 6, 8, 9, 10], "plot": [0, 3, 8, 9, 14, 18, 22, 23, 24], "tool": [0, 3], "so": [1, 2, 3, 8, 9, 11, 12, 17, 18, 19, 21, 27], "call": [1, 2, 3, 5, 6, 8, 9, 11, 12, 14, 18, 23, 25, 27], "cluster": [1, 2, 3, 4, 5, 9, 10, 13, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28], "valid": [1, 2, 8, 9, 10, 14, 20, 23, 26, 28], "indic": [1, 2, 4, 6, 8, 9, 11, 16, 17, 18, 19, 21, 23, 26], "The": [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19, 20, 22, 23, 24, 25, 26, 27, 28], "greater": [1, 2, 3, 11, 23, 27], "index": [1, 2, 3, 4, 5, 7, 8, 11, 12, 14, 16, 18, 19, 20, 21, 23, 26], "valu": [1, 2, 3, 4, 5, 6, 7, 18, 24], "more": [1, 2, 3, 4, 7, 8, 9, 11, 15, 18, 20, 21, 22, 23, 26, 27], "whatev": [1, 11, 22], "mean": [1, 2, 3, 8, 11, 19, 20, 21, 22, 23, 25, 27, 28], "assess": [1, 11], "partit": [1, 2, 3, 5, 8, 10, 11, 14, 18, 20, 21, 22, 23, 24, 27, 28], "For": [1, 2, 3, 4, 5, 11, 12, 13, 16, 18, 19, 20, 22, 23, 27], "consist": [1, 11], "ball": [1, 8, 11, 25], "hall": [1, 8, 11], "davi": [1, 8, 11], "bouldin": [1, 8, 11], "take": [1, 3, 4, 11, 14, 16, 19, 25, 27], "neg": [1, 2, 4, 11, 12, 16], "These": [1, 2, 4, 12, 16], "measur": [1, 2, 4, 8, 9, 10, 14, 18, 21, 23, 28], "were": [1, 19, 21, 22, 25, 27], "critic": [1, 11], "review": [1, 2, 11, 12, 25, 28], "gagolewski": [1, 2, 3, 5, 8, 9, 11, 12, 13, 14, 15, 16, 17, 28], "bartoszuk": [1, 3, 5, 8, 9, 11, 14, 16, 28], "cena": [1, 3, 5, 8, 9, 11, 14, 16, 28], "2022": [1, 2, 11, 12, 28], "http": [1, 2, 3, 5, 9, 11, 12, 13, 14, 15, 16, 17, 18, 23, 26, 28], "doi": [1, 2, 3, 5, 9, 11, 12, 13, 14, 15, 16, 17, 28], "org": [1, 2, 5, 13, 26, 28], "10": [1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 27, 28], "1016": [1, 3, 5, 9, 11, 12, 13, 14, 15, 16, 17, 28], "j": [1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 14, 15, 16, 17, 22, 28], "ins": [1, 3, 5, 9, 11, 14, 16, 28], "2021": [1, 11, 12, 13, 14, 15, 16, 17, 28], "004": [1, 9, 11, 28], "preprint": [1, 2, 11, 12, 28], "see": [1, 2, 3, 5, 6, 9, 18, 19, 20, 21, 23, 26, 27], "section": [1, 11, 12, 18, 19, 20, 21, 27], "2": [1, 2, 3, 4, 6, 7, 8, 11, 12, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 27, 28], "therein": [1, 2, 11], "respect": [1, 2, 3, 6, 8, 9, 11, 12, 14, 17, 19, 21, 22, 25, 27], "definit": [1, 2, 8, 11, 12, 14, 18, 24, 25], "even": [1, 3, 4, 8, 22, 27], "detail": [1, 2, 3, 8, 9, 13, 15, 18, 20, 23, 26], "framework": [1, 2, 11, 12], "benchmark": [1, 2, 3, 8, 9, 11, 12, 14, 18, 23, 26, 27, 28], "algorithm": [1, 2, 3, 4, 5, 8, 9, 10, 11, 12, 13, 16, 17, 18, 19, 20, 21, 22, 25, 27, 28], "calinski_harabasz_index": [1, 9, 11], "x": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 22, 23, 24, 25, 27, 28], "y": [1, 2, 3, 5, 6, 11, 12, 13, 24, 28], "comput": [1, 2, 3, 4, 5, 8, 9, 11, 12, 14, 17, 18, 19, 23, 27, 28], "cali\u0144ski": [1, 8], "harabasz": [1, 8, 11], "3": [1, 2, 3, 4, 6, 7, 11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28], "1": [1, 2, 3, 4, 5, 6, 7, 11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28], "discuss": [1, 8, 9, 20, 27], "paramet": [1, 2, 3, 4, 5, 6, 7, 8, 9, 14, 18, 19, 20, 22, 24, 27], "c_contigu": [1, 2], "ndarrai": [1, 2, 3, 4, 5, 7], "shape": [1, 2, 3, 5, 6, 18, 22], "n": [1, 2, 3, 4, 5, 6, 7, 8, 11, 12, 14, 16, 17, 18, 22, 25, 28], "d": [1, 3, 8, 11, 12, 14, 17, 18, 22, 23, 25, 28], "data": [1, 2, 3, 4, 7, 8, 11, 12, 13, 14, 16, 17, 18, 22, 23, 24, 27, 28], "point": [1, 2, 3, 6, 11, 12, 14, 17, 18, 19, 20, 23, 27], "featur": [1, 3, 13, 14, 17, 18, 19, 21, 22, 23, 25, 27], "space": [1, 3, 9, 11, 13, 14, 17, 18, 19, 27, 28], "dimension": [1, 3, 9, 11, 13, 14, 17, 19, 27], "array_lik": [1, 2, 6], "A": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 25, 28], "vector": [1, 2, 3, 4, 5, 6, 7, 11, 12, 14, 16, 20], "small": [1, 2, 3, 7, 8, 14, 19, 25, 27], "integ": [1, 2, 3, 5, 6, 7, 11, 12, 14, 25], "repres": [1, 2, 5, 11, 12, 17], "input": [1, 2, 3, 8, 12, 14, 17, 18, 23, 25, 27], "i": [1, 2, 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 28], "id": [1, 3, 5, 11, 23, 25], "th": [1, 3, 5, 7, 11, 14, 17, 25], "where": [1, 2, 3, 4, 5, 6, 7, 11, 12, 14, 17, 19, 25], "0": [1, 2, 3, 4, 5, 6, 7, 12, 14, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28], "k": [1, 2, 3, 5, 6, 7, 8, 11, 12, 14, 16, 17, 20, 21, 23, 27, 28], "number": [1, 3, 4, 5, 8, 11, 14, 16, 17, 18, 20, 22, 23, 24], "return": [1, 2, 3, 4, 5, 7, 12, 14, 22, 25], "float": [1, 3, 7, 14, 17], "dunnowa_index": [1, 9, 11], "generalis": [1, 8, 9, 11, 17], "dunn": [1, 8, 9, 11], "base": [1, 2, 3, 8, 9, 12, 13, 14, 17, 20, 21, 23, 25, 26, 27, 28], "neighbour": [1, 3, 8, 9, 11, 14, 17, 18, 19, 25, 26, 27], "owa": [1, 11], "oper": [1, 5, 11], "generalised_dunn_index": [1, 9, 11], "bezdek": [1, 11], "pal": [1, 11], "negated_ball_hall_index": [1, 9, 11], "negat": 1, "negated_davies_bouldin_index": [1, 9, 11], "negated_wcss_index": [1, 9, 11], "within": [1, 8, 11, 20], "sum": [1, 2, 11, 12], "squar": [1, 3, 11, 21], "us": [1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 20, 22, 23, 26, 27, 28], "object": [1, 3, 6, 12, 13, 14, 17, 18, 23, 24, 25], "function": [1, 2, 5, 6, 7, 8, 9, 12, 18], "ward": [1, 8, 20, 21, 24, 27], "silhouette_index": [1, 9, 11], "silhouett": [1, 8, 11], "averag": [1, 8, 11, 20, 21, 23, 24], "score": [1, 2, 4, 8, 10, 14, 16, 18, 20, 21, 23], "silhouette_w_index": [1, 9, 11], "w": [1, 3, 11, 13, 14, 28], "width": 1, "wcnn_index": [1, 9, 11], "refer": [1, 2, 3, 4, 8, 18, 19, 20, 21, 22, 23, 26, 27], "m": [1, 2, 3, 5, 6, 8, 9, 11, 12, 13, 14, 15, 16, 17, 22, 23, 28], "com": [1, 2, 3, 9, 11, 12, 13, 14, 15, 16, 17, 18, 23, 26, 28], "ar": [1, 2, 3, 4, 5, 6, 8, 9, 11, 12, 14, 16, 17, 18, 19, 20, 22, 23, 25, 27, 28], "inform": [1, 2, 3, 5, 8, 11, 12, 14, 16, 17, 20, 21, 28], "scienc": [1, 3, 5, 11, 14, 16, 17, 28], "581": [1, 11, 28], "620": [1, 11, 28], "636": [1, 11, 28], "calinski": [1, 11], "t": [1, 8, 11, 14, 18, 23, 25], "dendrit": [1, 11], "method": [1, 3, 8, 11, 12, 14, 17, 18, 20, 23, 24, 27, 28], "analysi": [1, 3, 11, 13, 17, 28], "commun": [1, 11], "statist": [1, 7, 11, 19, 20, 21, 28], "1974": [1, 11, 25], "27": [1, 7, 11, 21, 25, 27], "1080": [1, 11], "03610927408827101": [1, 11], "25": [1, 6, 19, 20, 21, 22, 23, 27], "owa_numer": [1, 11], "smin": [1, 11], "5": [1, 2, 3, 7, 11, 12, 13, 14, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27], "owa_denomin": [1, 11], "const": [1, 11], "int": [1, 3, 6, 7, 24, 25], "nearest": [1, 3, 8, 9, 11, 14, 17, 18, 19], "str": [1, 3, 26], "specifi": [1, 2, 11, 12, 28], "one": [1, 3, 4, 6, 7, 8, 11, 13, 14, 16, 17, 18, 19, 21, 22, 25, 26, 27], "min": [1, 2, 7, 11, 19, 20, 21], "max": [1, 2, 3, 6, 7, 11, 14, 17, 19, 20, 21, 24, 25], "smax": [1, 11], "code": [1, 9], "an": [1, 2, 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 16, 17, 18, 22, 23, 25, 26, 27], "defin": [1, 2, 6, 11, 12, 17, 20], "degre": [1, 11, 26], "smooth": [1, 3, 8, 11, 14, 17], "lowercase_d": [1, 11], "uppercase_d": [1, 11], "between": [1, 2, 3, 7, 11, 12, 13, 14, 17, 18, 19, 20, 21, 22, 25, 26], "denot": [1, 3, 5, 11, 14, 18, 20, 21, 22], "d_1": [1, 11], "d_5": [1, 11], "numer": [1, 3, 4, 11, 12, 13, 14, 16, 17], "pairwis": [1, 2, 3, 8, 10, 11, 14, 27], "intraclust": [1, 11], "distanc": [1, 3, 8, 9, 10, 11, 14, 19, 21, 22, 23, 26, 27], "centroid": [1, 11, 20, 21, 27], "weight": [1, 3, 11, 14, 17], "d_3": [1, 11], "denomin": [1, 11], "some": [1, 2, 3, 5, 8, 9, 11, 12, 17, 20, 21, 27], "new": [1, 3, 5, 8, 11, 14, 16, 22, 23, 25, 28], "ieee": [1, 2, 11, 12, 28], "transact": [1, 2, 11, 12, 28], "system": [1, 3, 11, 27, 28], "man": [1, 11], "cybernet": [1, 11], "part": [1, 2, 3, 11, 12, 20, 25, 27], "b": [1, 3, 4, 8, 11, 13, 14, 16, 17, 18, 28], "28": [1, 2, 11, 12, 21, 27, 28], "1998": [1, 11, 25], "301": [1, 11], "315": [1, 11], "1109": [1, 2, 11, 28], "3477": [1, 11], "678624": [1, 11], "g": [1, 2, 3, 4, 5, 8, 11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 25, 26, 27, 28], "h": [1, 4, 8, 11, 14, 16, 18, 22, 23, 28], "isodata": [1, 11], "novel": [1, 11], "pattern": [1, 11, 28], "classif": [1, 2, 11, 12, 21, 28], "technic": [1, 11], "report": [1, 11, 20], "No": [1, 4, 11], "ad699616": [1, 11], "stanford": [1, 11], "research": [1, 2, 11, 12, 28], "institut": [1, 11, 28], "1965": [1, 11, 25], "l": [1, 2, 3, 6, 11, 12, 28], "separ": [1, 11, 17], "machin": [1, 2, 3, 11, 12, 13, 28], "intellig": [1, 11, 28], "pami": [1, 11], "1979": [1, 11, 25], "224": [1, 11, 25], "227": [1, 11], "tpami": [1, 11], "4766909": [1, 11], "rousseeuw": [1, 11], "p": [1, 2, 3, 11, 12, 13, 17, 18, 20, 27, 28], "graphic": [1, 6, 11, 18], "aid": [1, 11], "interpret": [1, 11], "appli": [1, 3, 9, 11, 14, 18, 20, 22, 27, 28], "mathemat": [1, 11], "20": [1, 2, 11, 12, 19, 20, 21, 26, 27, 28], "1987": [1, 11, 25], "53": [1, 11, 21, 25, 28], "65": [1, 2, 4, 11, 21, 27], "0377": [1, 11], "0427": [1, 11], "87": [1, 11, 21, 27], "90125": [1, 11], "7": [1, 3, 4, 7, 9, 11, 16, 19, 20, 21, 22, 23, 27, 28], "extern": [2, 8, 10, 14, 23, 26, 28], "similar": [2, 8, 10, 14, 18, 19, 20, 21, 23, 25, 26], "can": [2, 3, 4, 6, 8, 9, 12, 14, 16, 17, 18, 21, 22, 23, 26, 27], "compar": [2, 8, 12, 18, 27, 28], "output": [2, 3, 8, 12, 18, 19, 20, 24], "ground": [2, 12, 20], "truth": [2, 12, 20], "label": [2, 3, 6, 8, 11, 12, 17, 18, 20, 22, 26], "adjusted_asymmetric_accuraci": [2, 9, 12], "adjust": [2, 8, 12, 18, 19, 20, 21, 23, 26, 28], "asymmetr": [2, 8, 12, 28], "accuraci": [2, 8, 12, 21, 28], "aaa": 2, "two": [2, 3, 6, 12, 18, 25, 27, 28], "ident": [2, 12, 27], "length": [2, 3, 5, 6, 7, 12], "same": [2, 5, 6, 12, 18, 20, 25, 27], "set": [2, 3, 4, 5, 6, 8, 12, 14, 16, 17, 18, 20, 21, 22, 23, 24, 26, 27, 28], "whose": [2, 3, 5, 7, 11, 14], "qualiti": [2, 11, 18, 20, 27], "we": [2, 3, 8, 11, 12, 14, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27], "would": [2, 18, 25], "like": [2, 3, 7, 8, 9, 13, 14, 17, 18, 27], "ass": 2, "doubl": [2, 4, 7], "multipl": [2, 17, 20, 28], "confus": [2, 12, 18], "matrix": [2, 3, 6, 11, 12, 13, 14, 17, 18, 23, 24, 25, 26], "compare_partitions2": 2, "normalized_confusion_matrix": [2, 9, 12, 18], "determin": [2, 3, 8, 9, 12, 17, 25, 27], "permut": [2, 4, 12, 16], "row": [2, 3, 11, 12, 17, 21, 23, 25], "column": [2, 3, 6, 11, 12, 13, 14, 17, 21, 23], "element": [2, 3, 4, 5, 7, 12, 14, 16, 25], "main": [2, 12], "diagon": [2, 12], "largest": [2, 12], "possibl": [2, 12, 18, 23, 24], "note": [2, 3, 4, 5, 6, 7, 8, 12, 14, 17, 18, 19, 23, 24, 26, 27, 28], "let": [2, 5, 18, 19, 22, 23, 25, 26, 27], "c": [2, 3, 4, 8, 9, 11, 12, 14, 16, 17, 23, 28], "It": [2, 3, 7, 8, 12, 13, 14, 17, 18, 22, 24, 26], "correct": [2, 3, 12, 14, 28], "chanc": [2, 12, 28], "summari": [2, 8, 12], "proport": [2, 12], "correctli": [2, 12], "classifi": [2, 12, 22], "each": [2, 3, 5, 6, 8, 12, 14, 17, 19, 20, 21, 22, 23, 27], "match": [2, 8, 12, 18, 21, 28], "solut": [2, 3, 11, 12, 20], "maxim": [2, 9, 12, 20], "linear": [2, 12], "assign": [2, 4, 6, 8, 9, 12, 16, 18, 26], "problem": [2, 8, 9, 12, 27], "normalize_confusion_matrix": 2, "given": [2, 3, 4, 5, 12, 14, 16, 17, 18, 25, 27], "max_": [2, 12], "sigma": [2, 4, 12, 16], "sum_": [2, 4, 5, 12, 16], "c_": [2, 12], "thi": [2, 3, 5, 6, 9, 12, 14, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27], "symmetr": [2, 12], "e": [2, 3, 4, 5, 8, 12, 13, 14, 16, 17, 18, 19, 20, 23, 25, 28], "doe": [2, 3, 14, 19, 27], "have": [2, 4, 5, 16, 19, 20, 21, 22, 27], "equal": [2, 4, 6, 7, 16, 18, 20, 22], "well": [2, 3, 6, 11, 12, 17, 18, 20, 28], "behav": [2, 12, 19, 28], "under": [2, 8, 12, 22, 28], "48550": [2, 12, 28], "arxiv": [2, 12, 28], "2209": [2, 12, 28], "02935": [2, 12, 28], "adjusted_fm_scor": [2, 12], "fowlk": [2, 8, 12, 21, 28], "mallow": [2, 8, 12, 21, 28], "adjusted_mi_scor": [2, 12], "mutual": [2, 3, 8, 9, 12, 14, 17, 21, 22], "mathrm": 2, "ami": 2, "_": 2, "adjusted_rand_scor": [2, 12, 14, 18, 26], "rand": [2, 8, 12, 18, 19, 20, 21, 23, 24, 26], "seri": [2, 27], "conting": 2, "tabl": [2, 12, 25], "le": 2, "dict": [2, 3, 26], "dictionari": [2, 3], "follow": [2, 4, 16, 18], "kei": 2, "r": [2, 3, 6, 9, 13, 14, 17, 27, 28], "unadjust": [2, 8, 12], "afm": 2, "fm": [2, 8, 12], "mi": [2, 8], "nmi": 2, "normalis": [2, 4, 5, 8, 16, 21], "nacc": 2, "psi": [2, 8, 12], "pair": [2, 6, 8, 12, 21, 23], "spsi": 2, "simplifi": [2, 9, 12], "nan": [2, 21], "neq": 2, "assum": [2, 3, 12], "confusion_matrix": 2, "wrapper": 2, "around": 2, "accept": [2, 3, 12, 17], "normalized_accuraci": [2, 12], "pair_sets_index": [2, 9, 12, 14], "rand_scor": [2, 12], "fm_score": [2, 12], "mi_scor": [2, 12], "normalized_mi_scor": [2, 12], "nonempti": [2, 12], "disjoint": [2, 5, 6, 8, 12], "subset": [2, 5, 12], "instanc": [2, 3, 12, 27], "dataset": [2, 3, 8, 12, 14, 17, 18, 19, 22, 23, 25, 26, 28], "observ": [2, 3, 12, 17, 19, 20, 25, 27], "moreov": [2, 3, 17, 20, 22, 27], "leq": [2, 12], "correspond": [2, 3, 6, 14, 17, 18, 19, 22], "also": [2, 18, 20, 22, 23, 24, 25, 26, 27], "implement": [2, 3, 5, 8, 9, 11, 13, 16, 17, 18, 20, 21, 22, 25, 26, 27], "few": [2, 3, 18, 20, 23, 25, 27], "aim": 2, "quantifi": [2, 3, 4, 12, 16, 19, 20], "except": [2, 5, 12, 19, 23, 27], "act": [2, 3, 8, 12, 14], "which": [2, 3, 8, 9, 12, 14, 17, 18, 19, 20, 21, 22, 25, 27], "alwai": [2, 5, 6, 12], "up": [2, 3, 12, 14, 17, 20, 24, 27], "biject": [2, 12], "4": [2, 3, 6, 7, 11, 12, 14, 17, 18, 20, 21, 23, 24, 25, 27], "onli": [2, 3, 6, 8, 9, 12, 14, 18, 19, 20, 23, 24, 25, 27], "version": [2, 3, 9, 12, 14, 18, 19, 20, 21, 25, 27, 28], "sometim": [2, 3, 8, 12, 20], "rate": [2, 12, 21, 25], "pivot": [2, 9, 12, 18], "give": [2, 3, 4, 6, 12, 14, 16, 17, 18, 20, 23, 26, 27], "transform": [2, 12, 24, 25], "Its": [2, 3, 8, 11, 12, 14, 18], "eq": [2, 12], "instead": [2, 3, 9, 12, 14, 17, 18], "18": [2, 12, 19, 21, 24, 27, 28], "probabl": [2, 12, 28], "agreement": [2, 12, 20, 21], "its": [2, 3, 5, 6, 8, 12, 14, 18, 27], "especi": 2, "expect": [2, 6, 12, 20], "independ": [2, 3, 12], "due": [2, 12], "result": [2, 3, 5, 8, 12, 14, 18, 19, 20, 22, 24, 27], "might": [2, 3, 7, 12, 14, 17, 18, 20, 22, 27], "similarli": [2, 12], "both": [2, 3, 12], "bound": [2, 12], "from": [2, 3, 4, 6, 8, 9, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 27, 28], "below": [2, 3, 9, 12, 20, 23, 24, 28], "henc": [2, 3, 12, 14, 20, 27], "prefer": [2, 7, 12], "theoret": [2, 8, 12, 20, 28], "hubert": [2, 12, 28], "arabi": [2, 12, 28], "journal": [2, 3, 11, 12, 13, 28], "1985": [2, 12, 25, 28], "193": [2, 12, 28], "218": [2, 12, 28], "rezaei": [2, 12, 28], "franti": [2, 12], "knowledg": [2, 12, 28], "mine": [2, 12, 24, 28], "8": [2, 3, 5, 7, 12, 14, 16, 18, 20, 21, 22, 23, 24, 27, 28], "2016": [2, 3, 5, 12, 14, 16, 28], "2173": [2, 12, 28], "2186": [2, 12, 28], "tkde": [2, 28], "2551240": [2, 28], "vinh": [2, 12, 28], "epp": [2, 12, 28], "bailei": [2, 12, 28], "comparison": [2, 8, 12, 28], "variant": [2, 12, 18, 27], "properti": [2, 3, 6, 12, 14, 28], "normal": [2, 12, 24, 28], "learn": [2, 3, 8, 12, 13, 18, 20, 24, 27, 28], "11": [2, 12, 18, 19, 20, 21, 27, 28], "2010": [2, 3, 12, 13, 28], "2837": [2, 12, 28], "2854": [2, 12, 27, 28], "exampl": [2, 4, 6, 7, 18, 22, 24], "np": [2, 4, 6, 7, 18, 22, 24, 25, 26, 27], "r_": [2, 4, 6, 7], "arrai": [2, 3, 5, 7, 18, 24], "round": [2, 4, 20], "v": [2, 16, 17, 25, 28], "item": [2, 21], "49": [2, 21], "74": [2, 21, 27], "73": [2, 20, 21], "29": [2, 12, 19, 21, 27], "41": [2, 21], "39": [2, 21], "71": [2, 21, 27], "63": [2, 17, 21], "underli": 2, "dens": [2, 3, 21, 25], "6": [2, 3, 4, 7, 16, 17, 20, 21, 22, 23, 24, 27], "origin": [2, 3, 8, 9, 14, 17, 18, 19, 22, 24, 27], "solv": [2, 8, 9, 12, 27], "count": [2, 18, 19, 20, 21], "than": [2, 3, 5, 8, 19, 23, 27], "normalizing_permut": [2, 9, 12], "order": [2, 3, 4, 5, 7, 14, 16, 23, 27], "come": [2, 18, 26], "handi": 2, "when": [2, 3, 22, 28], "summaris": [2, 18, 21], "gener": [2, 3, 5, 7, 9, 14, 18, 19, 20, 24, 27], "actual": [2, 3], "do": [2, 3, 5, 26, 27], "matter": [2, 6, 25], "remap": 2, "chang": [2, 3, 20, 27], "use_sum": 2, "bool": [2, 3, 4], "whether": [2, 3, 12, 13, 14, 17], "should": [2, 3, 14, 18, 20], "class": [3, 5, 13, 14, 17, 18, 25], "n_cluster": [3, 8, 18, 20, 22, 24, 25, 26, 27], "gini_threshold": [3, 14, 18, 19, 20, 22, 23, 27], "affin": [3, 20, 25, 26], "l2": [3, 14, 17], "exact": [3, 19, 25, 26, 27], "true": [3, 11, 12, 14, 17, 18, 22, 26, 27], "compute_full_tre": [3, 18], "fals": [3, 4, 12, 13, 14, 17, 18, 19, 25, 26, 27], "compute_all_cut": 3, "postprocess": [3, 14], "boundari": [3, 14, 17], "cast_float32": [3, 14, 17, 23, 26], "mlpack_en": [3, 27], "auto": [3, 27], "mlpack_leaf_s": 3, "nmslib_n_neighbor": 3, "64": [3, 14, 17, 21, 27], "nmslib_params_init": 3, "hnsw": 3, "nmslib_params_index": [3, 26], "post": [3, 26], "nmslib_params_queri": 3, "verbos": [3, 13, 14, 17, 23], "hierarch": [3, 5, 9, 10, 11, 12, 13, 16, 17, 18, 20, 22, 23, 24, 27, 28], "detect": [3, 11, 14, 23, 27], "If": [3, 5, 6, 14, 17, 18, 23, 26], "all": [3, 4, 5, 6, 14, 16, 17, 19, 20, 21, 24, 27], "nois": [3, 14, 17, 18, 19, 21, 23, 24, 27, 28], "outlier": [3, 5, 8, 14, 16, 28], "detector": [3, 8, 14], "approxim": [3, 8, 9, 25, 27], "fail": [3, 20], "coarsest": 3, "grain": 3, "case": [3, 5, 6, 14, 17, 19, 21, 27], "warn": [3, 24, 26], "threshold": [3, 14, 18, 20], "gini": [3, 4, 5, 8, 14, 16, 18], "size": [3, 4, 5, 8, 13, 14, 16, 17, 18, 24, 27], "distribut": [3, 5, 8, 14, 20, 24], "low": [3, 9, 13, 14, 17, 27], "highli": [3, 8, 14, 27], "penalis": [3, 14], "format": [3, 8, 14, 25], "disabl": [3, 14, 22], "make": [3, 8, 14, 17, 18, 25, 26], "equival": [3, 6], "singl": [3, 8, 11, 12, 14, 19, 20, 21, 24, 27, 28], "linkag": [3, 8, 14, 17, 19, 20, 21, 24, 27], "tend": [3, 20, 22], "stabl": [3, 18, 20, 23, 28], "thei": [3, 4, 16, 19, 20, 25, 27], "affect": [3, 18, 20], "usual": 3, "worth": [3, 8, 14, 18, 20, 24], "try": [3, 8, 14, 20, 24], "factor": [3, 8, 14, 17, 24], "reachabl": [3, 8, 9, 14, 17, 22], "chosen": [3, 14, 17], "need": [3, 5, 27], "addition": 3, "o": [3, 4, 5, 7, 9, 14, 16, 17, 25, 27], "work": [3, 7], "memori": [3, 7, 8, 13, 17, 27], "store": [3, 25, 27], "metric": [3, 13, 14, 17, 18, 26, 27, 28], "One": [3, 4], "synonym": [3, 14, 17], "euclidean": [3, 6, 9, 10, 14, 17, 19, 21, 22, 23, 27], "l1": [3, 14, 17], "manhattan": [3, 14, 17], "cityblock": [3, 14, 17], "cosinesimil": 3, "cosin": [3, 14, 17, 25], "precomput": 3, "In": [3, 6, 7, 9, 18, 19, 20, 21, 23, 27, 28], "latter": [3, 6, 20], "argument": [3, 6], "fit": [3, 8, 18, 20, 24, 25, 27], "must": [3, 5, 6], "form": [3, 8, 25], "scipi": [3, 6, 18, 25], "spatial": [3, 6, 28], "pdist": 3, "ani": [3, 6, 8, 22, 26, 27], "dissimilar": 3, "support": [3, 8, 9, 25], "nmslib": [3, 8, 9, 19, 25, 26, 27, 28], "github": [3, 8, 9, 14, 18, 23, 26, 28], "blob": [3, 24, 27, 28], "master": [3, 11, 18, 23, 26, 28], "manual": [3, 11, 12, 13, 14, 15, 16, 17, 18, 23, 28], "md": 3, "l2_spars": 3, "l1_spars": 3, "linf": 3, "linf_spars": 3, "cosinesimil_spars": [3, 25], "negdotprod": 3, "negdotprod_spars": 3, "angulardist": 3, "angulardist_spars": 3, "leven": [3, 26], "normleven": 3, "jaccard_spars": 3, "bit_jaccard": 3, "bit_ham": 3, "minimum": [3, 6, 7, 9, 10, 14, 20, 22, 27, 28], "span": [3, 6, 8, 9, 10, 14, 20, 22, 27, 28], "tree": [3, 6, 8, 9, 10, 14, 18, 20, 22, 23, 24, 26, 27, 28], "exactli": 3, "rather": 3, "estim": [3, 14, 17, 28], "graph": [3, 8, 9, 10, 14, 21, 27, 28], "ha": [3, 4, 9, 16, 21, 23, 27], "time": [3, 4, 5, 7, 8, 9, 13, 14, 16, 17, 20, 23, 24], "complex": [3, 4, 16, 17, 27], "howev": [3, 8, 14, 18, 20, 27], "found": [3, 21, 22], "typic": [3, 20], "veri": [3, 7, 8, 13, 14, 17, 26, 27], "fast": [3, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 19, 22, 28], "requir": [3, 9], "whole": [3, 8, 14, 25], "hierarchi": [3, 8, 14, 18, 25, 27], "avail": [3, 8, 9, 13, 20, 23, 27], "enabl": 3, "dendrogram": [3, 8, 14, 23], "cut": 3, "arbitrari": [3, 14], "level": [3, 14, 27], "children_": [3, 18], "distances_": [3, 18], "counts_": [3, 18], "attribut": [3, 17], "request": [3, 17, 27], "coarser": [3, 22], "ones": [3, 19, 22], "labels_": [3, 24], "none": [3, 6, 14, 24], "control": [3, 13, 14, 17, 22], "treatment": 3, "after": [3, 8], "identifi": [3, 14, 17, 22, 23], "effect": [3, 14, 22, 27], "leaf": 3, "treat": 3, "amongst": [3, 4, 14, 16, 18, 27], "adjac": [3, 14], "vertex": [3, 14], "": [3, 8, 18, 19, 20, 22, 23, 24, 25, 26, 27, 28], "By": [3, 14, 22, 27], "default": [3, 9, 14, 17, 18, 20, 22, 23, 27], "merg": [3, 5, 8, 14, 18], "core": [3, 8, 9, 14, 27], "To": [3, 8, 14, 18, 25, 26], "forc": [3, 14], "classic": [3, 8, 14], "notion": [3, 14, 18], "choos": [3, 14], "furthermor": 3, "leav": [3, 13, 14], "includ": [3, 8, 20], "cast": 3, "type": [3, 7, 25, 26], "float32": [3, 25], "perform": [3, 14, 19, 21, 25, 26, 27], "decreas": [3, 4, 16], "run": [3, 5, 7, 14, 19, 24, 25, 27], "ca": 3, "cost": [3, 5], "otherwis": [3, 5, 11, 14, 16, 17], "anywai": 3, "spars": [3, 8], "user": [3, 18, 22, 25, 28], "assur": 3, "themself": 3, "mlpack": [3, 9, 13, 27, 28], "emst": [3, 13, 27], "jarn\u00edk": [3, 27], "prim": [3, 9, 13, 17, 27], "often": [3, 8, 14], "As": [3, 19, 20], "name": [3, 17, 23, 24, 25], "suggest": [3, 9, 20], "reli": [3, 5, 18, 19, 22, 25, 26], "instal": [3, 8, 18, 23, 25, 26], "n_featur": 3, "kd": [3, 13], "accord": [3, 14], "best": [3, 8, 14, 20, 21, 25], "too": [3, 17, 18], "disconnect": [3, 8], "obtain": [3, 14, 18, 22, 23, 26], "less": [3, 19, 27], "pass": [3, 6, 14, 17], "init": 3, "io": 3, "data_typ": 3, "dtype": [3, 18, 22, 25, 26], "createindex": 3, "construct": 3, "indexthreadqti": 3, "omp_num_thread": [3, 14, 17], "environ": [3, 8, 14, 17], "variabl": [3, 14, 17, 20], "setquerytimeparam": 3, "print": [3, 13, 14, 17, 23, 25, 26, 27], "diagnost": [3, 13, 14, 17], "messag": [3, 13, 14, 17, 24], "progress": [3, 14, 17], "stderr": 3, "robust": [3, 9, 11, 12, 13, 14, 15, 16, 17, 28], "resist": [3, 5, 8, 14, 16, 28], "publish": 3, "packag": [3, 5, 6, 9, 13, 18, 20, 21, 22, 23, 25, 26, 27], "other": [3, 4, 5, 8, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 25, 27, 28], "much": [3, 8, 9, 18, 19, 20, 27], "faster": [3, 8, 9, 14, 17, 19, 23, 26, 27], "now": [3, 9, 14, 22, 25, 27], "option": [3, 9, 25, 26], "mst": [3, 6, 8, 10, 13, 14, 23, 27, 28], "just": [3, 14, 27], "consum": [3, 14], "edg": [3, 14, 17], "increas": [3, 14, 18, 27], "prevent": [3, 8, 14], "imbalanc": [3, 8, 14], "onc": [3, 6, 14, 22, 27], "rais": [3, 14], "abov": [3, 14, 18, 21, 25], "group": [3, 8, 14, 18, 21, 23], "smallest": [3, 5, 7, 8, 14, 18], "appeal": [3, 8, 14], "simplic": [3, 6, 8, 14], "goe": [3, 8, 14], "hand": [3, 8, 14, 18, 27], "usabl": [3, 8, 14], "outperform": [3, 8, 14, 18, 20], "approach": [3, 8, 14, 28], "itself": [3, 5, 26, 27], "sqrt": [3, 5, 14, 27], "provid": [3, 13, 14, 20, 22, 27], "our": [3, 9, 19, 22, 25, 27], "parallelis": [3, 9, 13, 14, 17, 27], "dijkstra": [3, 17, 27], "altern": [3, 14, 17, 27], "kruskal": [3, 27], "albeit": [3, 27], "sort": [3, 4, 7, 16, 17, 27], "forest": [3, 27], "structur": [3, 8, 27], "turn": [3, 18, 24, 27], "out": [3, 8, 18, 23, 24, 25, 27], "suitabl": [3, 27], "task": [3, 8, 17, 27], "connect": [3, 17, 24], "compon": [3, 24], "top": [3, 24, 25, 27], "depend": [3, 8, 9, 14, 25, 26, 27], "sure": [3, 25, 26], "your": [3, 8, 17, 24], "togeth": [3, 14, 18], "robustifi": [3, 8, 14, 18], "hdbscan": [3, 8, 9, 14, 21, 28], "contrari": [3, 22], "predecessor": [3, 8], "abl": [3, 8, 14, 18], "predefin": [3, 8, 14], "dbscan": [3, 8, 14, 18], "somewhat": [3, 8, 14, 18], "magic": [3, 14, 18], "ep": [3, 8, 14, 18], "min_cluster_s": [3, 14, 18, 22], "formal": 3, "raw": [3, 11, 14, 17, 21], "hold": [3, 4, 7, 14, 17], "being": [3, 5, 8, 14, 17], "pull": [3, 14, 17], "awai": [3, 4, 14, 16, 17], "dure": [3, 5], "procedur": [3, 22, 24], "process": [3, 11], "mai": [3, 8], "stage": [3, 21], "left": [3, 4, 16, 18, 24], "mark": [3, 14], "thread": [3, 8, 14, 17], "363": [3, 5, 14, 16, 28], "23": [3, 5, 14, 16, 19, 21, 27, 28], "05": [3, 5, 14, 16, 19, 20, 21, 24, 27, 28], "003": [3, 5, 14, 16, 28], "olson": [3, 17, 28], "f": [3, 17, 28], "parallel": [3, 17, 28], "21": [3, 17, 21, 27, 28], "1995": [3, 17, 25, 28], "1313": [3, 17, 28], "1325": [3, 17, 28], "0167": [3, 28], "8191": [3, 28], "95": [3, 21, 27, 28], "00017": [3, 28], "curtin": [3, 13, 28], "edel": [3, 13, 28], "lozhnikov": [3, 13, 28], "mentekidi": [3, 13, 28], "ghaisa": [3, 13, 28], "zhang": [3, 13, 28], "flexibl": [3, 13, 28], "librari": [3, 8, 13, 14, 17, 18, 23, 28], "open": [3, 8, 13, 18, 28], "sourc": [3, 8, 13, 20, 28], "softwar": [3, 13, 28], "26": [3, 7, 13, 21, 27, 28], "726": [3, 13, 28], "2018": [3, 13, 25, 28], "21105": [3, 28], "joss": [3, 28], "00726": [3, 28], "march": [3, 13, 28], "ram": [3, 13, 25, 28], "grai": [3, 13, 18, 28], "applic": [3, 4, 13, 16, 21, 28], "proc": [3, 13, 28], "acm": [3, 13, 28], "sigkdd": [3, 13, 28], "603": [3, 13, 28], "611": [3, 13], "naidan": [3, 28], "boytsov": [3, 28], "malkov": [3, 28], "novak": [3, 28], "non": [3, 4, 11, 16, 22, 25, 28], "2019": [3, 28], "latex": [3, 28], "pdf": [3, 6, 11, 13, 28], "campello": [3, 14, 17, 28], "moulavi": [3, 14, 17, 28], "sander": [3, 14, 17, 28], "densiti": [3, 14, 17, 28], "lectur": [3, 14, 17, 28], "7819": [3, 14, 17, 28], "2013": [3, 14, 17, 28], "160": [3, 14, 17, 28], "172": [3, 14, 17, 28], "1007": [3, 14, 17, 28], "978": [3, 14, 17, 28], "642": [3, 14, 17, 28], "37456": [3, 14, 17, 28], "2_14": [3, 14, 17, 28], "n_clusters_": 3, "unless": [3, 27], "taken": 3, "care": 3, "cardin": [3, 5, 27], "down": 3, "distinguish": 3, "conduct": 3, "fine": 3, "larger": [3, 20, 24, 27], "argu": 3, "yield": [3, 4, 16, 19, 25], "mani": [3, 18, 22], "n_samples_": 3, "n_features_": 3, "iter": 3, "descript": [3, 9, 19, 20], "z": 3, "constitut": 3, "guarante": 3, "increasingli": [3, 4, 7, 16], "violat": [3, 14], "ultrametr": [3, 14], "cummin": [3, 7, 14], "creat": [3, 24], "n_sampl": [3, 24], "ignor": [3, 24], "self": [3, 28], "wa": [3, 6, 9, 19, 20, 24, 25, 27], "either": [3, 6, 17], "squareform": 3, "real": 3, "numpi": [3, 9, 18, 22, 24, 25, 26, 27], "coercibl": [3, 12, 13, 14, 17], "good": [3, 8, 11, 19, 22, 27], "idea": [3, 8, 22], "standardis": [3, 14], "least": [3, 19, 20, 22, 27], "somehow": 3, "preprocess": [3, 21, 24], "coordin": [3, 6, 27], "axi": [3, 6, 9, 18, 22], "std": [3, 19, 20, 21], "ddof": 3, "centr": [3, 19, 21, 27], "total": [3, 4, 19, 21, 27], "varianc": [3, 19, 21, 24, 27], "wai": [3, 6, 20, 22, 25], "becom": [3, 27], "translat": [3, 27], "scale": [3, 19, 20, 21, 23, 27], "invari": 3, "what": [3, 8, 22], "record": 3, "precis": [3, 14, 17, 19], "sai": [3, 13], "decim": [3, 20], "digit": [3, 19, 20, 21, 27], "ad": [3, 9, 19, 21, 27], "tini": [3, 19, 21, 27], "bit": [3, 14, 17, 19, 21, 27], "gaussian": [3, 19, 20, 21, 27], "uniqu": [3, 11, 18, 22, 25, 26], "locat": [3, 7], "therefor": [3, 6, 8, 14, 27], "datatyp": 3, "describ": [3, 12], "csr_matrix": 3, "ascii": 3, "string": [3, 8, 11], "bonferroni_index": [4, 16], "is_sort": 4, "bonferroni": [4, 8, 16], "alreadi": 4, "devergottini_index": [4, 9, 16], "de": [4, 8, 16, 25], "vergottini": [4, 8, 16], "gini_index": [4, 14, 16], "x_1": [4, 5, 16], "dot": [4, 5, 16, 24], "x_n": [4, 16], "frac": [4, 5, 16], "right": [4, 16, 24], "x_": [4, 16], "x_i": [4, 5, 16], "elementi": [4, 16], "di": [4, 16], "statistica": [4, 16], "general": [4, 16], "libreria": [4, 16], "seber": [4, 16], "firenz": [4, 16], "1930": [4, 16, 17], "perfect": [4, 16, 18, 20, 21], "poor": [4, 16], "rich": [4, 16, 20], "91": [4, 21, 27], "robinhood": 4, "83": [4, 21], "77": [4, 21, 27], "x_j": [4, 5, 16], "2i": [4, 16], "sampl": [4, 11, 16, 20, 23, 24], "perceiv": [4, 16], "dispers": [4, 16], "constant": [4, 16], "equiti": [4, 16], "pigou": [4, 16], "dalton": [4, 16], "principl": [4, 16, 28], "schur": [4, 16], "convex": [4, 6, 16, 18], "geq": [4, 16], "econom": [4, 16, 18, 23], "variabilita": [4, 16], "mutabilita": [4, 16], "tipografia": [4, 16], "paolo": [4, 16], "cuppini": [4, 16], "bologna": [4, 16], "1912": [4, 16], "85": [4, 16, 21, 28], "75": [4, 9, 16, 19, 20, 21, 27, 28], "disjointset": 5, "union": [5, 8], "find": [5, 7, 8, 22], "py_ssize_t": 5, "path": [5, 8], "compress": [5, 25], "naiv": [5, 13], "neither": 5, "rank": [5, 20, 21], "nor": [5, 8], "en": 5, "wikipedia": 5, "wiki": 5, "set_data_structur": 5, "design": [5, 28], "current": 5, "assumpt": 5, "parent": 5, "get_k": 5, "get_n": 5, "to_list": 5, "get": [5, 11, 18, 20, 22, 25], "list": [5, 14, 18, 19, 23, 24, 26, 27], "recurs": 5, "to_list_norm": 5, "membership": 5, "slow": [5, 17, 27], "you": [5, 6, 14, 17, 26, 28], "realli": 5, "contain": 5, "first": [5, 6, 8, 14, 18, 22, 24, 25, 27], "second": [5, 25, 27], "whichev": 5, "smaller": [5, 20, 23], "px": 5, "py": [5, 26], "member": [5, 8, 23, 25], "thrown": 5, "ginidisjointset": 5, "augment": [5, 8], "over": [5, 13, 20], "allow": [5, 8, 20, 22, 26, 27], "x_k": 5, "pp": [5, 12, 16], "get_count": 5, "nondecreasingli": [5, 17], "get_gini": 5, "updat": [5, 9, 24], "get_smallest_count": 5, "pessimist": 5, "recomput": [5, 27], "variou": [6, 8, 20], "plot_scatt": [6, 9, 18, 22], "titl": [6, 9, 18, 22, 24, 25], "xlabel": [6, 9], "ylabel": [6, 9], "xlim": [6, 9, 24], "ylim": [6, 9, 24], "kwarg": 6, "draw": 6, "scatter": [6, 18, 22, 24], "style": 6, "matplotlib": [6, 18, 22, 24], "pyplot": [6, 18, 22, 24], "etc": [6, 8, 23], "collect": 6, "further": [6, 8, 14, 17, 27], "unlik": 6, "fix": [6, 9], "drawn": 6, "particular": [6, 9, 18, 19], "black": 6, "red": [6, 25], "green": 6, "blue": [6, 25], "inspir": 6, "distinct": 6, "100": [6, 7, 20, 27], "50": [6, 12, 19, 20, 21, 22, 27], "random": [6, 7, 24], "randn": 6, "repeat": 6, "plt": [6, 18, 22, 24], "show": [6, 18, 22, 24, 25], "png": 6, "hire": 6, "here": [6, 16, 18, 19, 20, 21, 22, 25, 26, 27], "ncol": 6, "len": [6, 18, 22, 24, 26], "col": [6, 14], "nmrk": 6, "mrk": 6, "mrk_recycl": 6, "tile": 6, "ceil": 6, "rang": [6, 18, 19, 22], "text": [6, 24], "horizontalalign": [6, 24], "center": 6, "marker": [6, 22], "color": [6, 23, 24], "markers": 6, "9": [6, 12, 19, 20, 21, 23, 24, 25, 27, 28], "off": [6, 13], "plot_seg": 6, "line": [6, 8, 18, 21], "segment": 6, "pretti": 6, "hull": 6, "import": [6, 8, 18, 22, 24, 25, 26, 27], "convexhul": 6, "mst_from_dist": 6, "necessarili": [7, 19], "argkmin": 7, "posit": 7, "argmin": 7, "argsort": 7, "nk": 7, "insert": 7, "scheme": 7, "practic": [7, 18], "randomli": 7, "almost": [7, 25, 27], "ascend": 7, "100000000": 7, "060": 7, "388": 7, "descend": 7, "168": 7, "329": 7, "073": 7, "673": 7, "403": 7, "505": 7, "414": 7, "072": 7, "447": [7, 19], "061": 7, "390": 7, "007": 7, "639": 7, "075": 7, "299": 7, "2nd": 7, "cummax": 7, "cumul": 7, "maximum": 7, "meaning": [8, 19, 24], "quickli": [8, 27], "larg": [8, 19, 28], "gag21": [8, 18, 28], "gbc16": [8, 18, 20, 22, 26, 28], "behind": 8, "beautifulli": 8, "simpl": [8, 25], "individu": 8, "sole": [8, 12], "own": 8, "Then": [8, 21, 24, 25], "keep": [8, 22], "closest": [8, 18], "anoth": [8, 18], "birch": [8, 20], "complet": [8, 9, 17, 19, 20, 21, 24, 27], "kind": 8, "Of": [8, 24, 27], "cours": [8, 18, 22, 24, 27], "ever": 8, "univers": 8, "everi": [8, 21], "thank": [8, 9, 27, 28], "minim": 8, "million": [8, 18, 19], "minut": [8, 19, 27], "capabl": 8, "extrem": [8, 27, 28], "nbmn19": [8, 27, 28], "cms13": [8, 18, 22, 28], "doesn": 8, "difficult": 8, "via": [8, 18], "pypi": [8, 9, 18], "pip3": [8, 18], "command": [8, 18], "through": 8, "favourit": 8, "manag": 8, "familiar": 8, "scikit": [8, 18, 20, 24, 27, 28], "13": [8, 18, 20, 21, 28], "look": [8, 22], "feel": [8, 22], "fit_predict": [8, 18, 22, 25, 26], "about": [8, 18, 27], "check": [8, 18, 23], "marek": [8, 11, 12, 13, 14, 15, 16, 17, 18], "recent": 8, "access": [8, 9, 13, 18], "free": [8, 18], "textbook": [8, 18], "minimalist": [8, 18, 28], "wrangl": [8, 18, 28], "gag22b": [8, 18, 28], "download": 8, "cran": [8, 9, 23], "interfac": [8, 18], "compat": [8, 14, 18, 23, 27], "stat": [8, 23], "hclust": [8, 14, 23], "gclust": [8, 10, 17, 23], "cutre": [8, 14, 23], "simpli": 8, "reimplement": [8, 14], "geniefi": 8, "retak": 8, "experiment": [8, 9, 12, 28], "preview": [8, 23, 26], "ic": [8, 28], "gic": [8, 9], "cen18": [8, 28], "minimis": 8, "criterion": 8, "mnl12": [8, 20, 28], "gag22a": [8, 28], "rf16": [8, 21, 28], "gbc21": [8, 28], "extens": 8, "gnu": [8, 27], "agpl": 8, "v3": 8, "licens": 8, "header": 8, "adapt": [8, 28], "rel": [8, 11], "easili": [8, 18, 22, 27], "valuabl": 8, "welcom": 8, "julia": 8, "matlab": 8, "author": [8, 9], "maintain": 8, "contributor": [8, 11, 12, 13, 14, 15, 16, 17], "maciej": [8, 9], "anna": [8, 9], "cvi": [8, 9], "peter": 8, "larsen": 8, "shortest": [8, 17], "rectangular": 8, "basic": [8, 23], "break": 8, "read": [8, 21, 23, 25], "toi": [8, 25], "how": [8, 18, 22, 23, 25], "comparis": 8, "movi": 8, "recommend": [8, 18, 19, 20, 27], "dna": 8, "python": [9, 18, 23, 25, 27, 28], "build": 9, "ssize_t": 9, "portabl": 9, "mention": [9, 22, 26], "modul": [9, 28], "backward": 9, "incompat": 9, "primit": 9, "partial": 9, "paper": [9, 13, 28], "softwarex": [9, 11, 12, 13, 14, 15, 16, 17, 28], "100722": [9, 11, 12, 13, 14, 15, 16, 17, 28], "softx": [9, 11, 12, 13, 14, 15, 16, 17, 28], "palett": [9, 23], "rcppmlpack": 9, "72": [9, 21, 27], "mere": 9, "upon": 9, "impli": 9, "directli": [9, 23], "remov": [9, 19, 21, 22, 27], "emstreer": 9, "tinytest": 9, "unit": [9, 23], "test": [9, 14, 20], "testthat": 9, "bugfix": 9, "error": 9, "solari": 9, "add": 9, "coverag": 9, "ci": 9, "minor": 9, "inconsist": 9, "autom": 9, "bdist": 9, "chain": 9, "meet": 9, "polici": 9, "broken": 9, "script": [9, 24], "openmp": 9, "been": [9, 21, 27], "rewritten": 9, "jarnik": [9, 17], "fly": [9, 17], "propos": 9, "her": 9, "phd": [9, 28], "thesi": [9, 28], "produc": [9, 25], "initi": 9, "releas": [9, 23, 26], "emst_mlpack": [10, 14, 17], "extra": [10, 25], "wcss": 11, "25l": 11, "better": [11, 19, 20, 23], "fuzzi": [11, 28], "compact": 11, "1973": [11, 25, 28], "32": [11, 14, 17, 19, 21, 27, 28], "57": [11, 17, 21, 27], "01969727308546046": 11, "githubusercont": 11, "gagolew": [11, 14, 18, 23, 26, 28], "bibliographi": 11, "2021cvi": 11, "offici": [11, 12, 13, 14, 15, 16, 17], "onlin": [11, 12, 13, 14, 15, 16, 17], "genieclust": [11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28], "15": [11, 12, 13, 14, 15, 16, 17, 18, 21, 22, 24, 27, 28], "iri": [11, 12, 14, 17, 21], "jitter": 11, "486": 11, "6681": 11, "nrow": 11, "replac": [11, 22], "bad": 11, "836713": 11, "null": 12, "wish": 12, "ami_": 12, "nmi_": 12, "et": [12, 14, 17], "al": [12, 14, 17], "reorder": 12, "built": 12, "standard": 12, "esp": 12, "meila": 12, "heckerman": 12, "model": [12, 28], "42": [12, 21, 27], "2001": 12, "1023": 12, "1007648401407": 12, "steinlei": 12, "psycholog": 12, "2004": 12, "386": 12, "396": 12, "1037": 12, "1082": 12, "989x": 12, "y_true": 12, "y_pred": [12, 14, 23, 24], "kmean": [12, 18, 27], "84": [12, 21, 27], "7568238": 12, "7470968": 12, "7302383": 12, "8797315": 12, "7304411": 12, "8208081": 12, "8255911": 12, "7581757": 12, "7551192": 12, "48": [12, 21, 27, 28], "14": [12, 21, 24, 27], "36": [12, 17, 21, 27], "dual": 13, "boruvka": 13, "higher": [13, 27], "leaf_siz": 13, "frame": [13, 14, 17, 23, 25], "trade": 13, "speed": [13, 18], "consumpt": 13, "logic": [13, 14, 17], "quadrat": 13, "s3": [14, 17, 21], "dist": [14, 17, 23], "1l": [14, 17, 23], "detect_nois": 14, "arithmet": [14, 17], "2x": [14, 17], "desir": [14, 20, 23], "select": [14, 17, 24], "most": [14, 24, 27], "want": [14, 26], "differ": [14, 19, 20, 22, 24, 27], "explicitli": [14, 20, 22], "occur": 14, "departur": 14, "height": 14, "rev": 14, "miss": 14, "na": 14, "routin": [14, 25, 26, 28], "y_test": 14, "pch": 14, "asp": 14, "la": 14, "8857921": 14, "9049708": 14, "90625": 16, "8333333": 16, "7662338": 16, "6493506": 16, "undirect": 17, "sy": 17, "setenv": 17, "gain": 17, "abil": 17, "suboptim": 17, "file": [17, 25], "vertic": 17, "nn": 17, "jistem": 17, "problemu": 17, "minimalnim": 17, "prace": 17, "moravsk": 17, "prirodovedeck": 17, "spolecnosti": 17, "network": 17, "bell": 17, "syst": 17, "tech": 17, "1957": 17, "1389": 17, "1401": 17, "agglom": [18, 20, 27, 28], "link": 18, "mind": [18, 27], "popular": 18, "go": 18, "far": 18, "beyond": 18, "happen": 18, "join": 18, "ll": [18, 23], "frequent": 18, "term": 18, "interact": [18, 23], "panda": [18, 22, 25], "pd": [18, 22, 25], "load": [18, 22, 25], "jain": [18, 21, 28], "jl05": [18, 28], "expert": [18, 22, 26], "devel": [18, 23, 26], "sphinx": [18, 23, 26], "weav": [18, 23], "2d": [18, 24], "loadtxt": [18, 22, 26, 27], "gz": [18, 22, 26, 27], "ndmin": [18, 22, 27], "them": [18, 22], "ish": 18, "subtract": 18, "labels_tru": [18, 22, 26], "labels0": [18, 22, 26], "intp": [18, 22, 26], "equip": 18, "labels_geni": [18, 22], "document": [18, 21, 23], "discov": [18, 28], "predict": [18, 19, 20, 22, 24], "nice": [18, 24, 27], "pictur": 18, "thousand": 18, "word": 18, "276": 18, "97": [18, 21, 27], "sklearn": [18, 24, 27], "sake": 18, "km": 18, "labels_kmean": 18, "known": [18, 20, 22], "split": 18, "region": 18, "voronoi": 18, "diagram": 18, "shouldn": 18, "surpris": 18, "197": 18, "79": [18, 19, 21, 27], "96": [18, 21, 24, 27, 28], "3241080446115835": 18, "sim": 18, "against": [18, 20, 27], "eksx96": [18, 28], "lin73": [18, 28], "hard": [18, 25], "tune": [18, 22], "mha17": [18, 22, 28], "friendli": 18, "mc": 18, "labels_hdbscan": [18, 22], "subplot": [18, 22, 24], "side": 18, "symbol": 18, "back": [18, 25], "demand": 18, "granular": [18, 22], "unfortun": 18, "cannot": 18, "guess": 18, "At": [18, 21, 27], "glanc": 18, "seem": 18, "lie": 18, "somewher": 18, "16": [18, 19, 21, 27], "strang": 18, "enough": 18, "wherea": 18, "pm": 18, "On": [18, 19, 27], "belong": 18, "sequenc": 18, "nest": 18, "subgroup": 18, "ncl": 18, "linkage_matrix": 18, "column_stack": 18, "show_leaf_count": 18, "no_label": 18, "truncate_mod": 18, "lastp": 18, "orient": 18, "api": [18, 21, 28], "previou": [19, 27], "demonstr": [19, 27], "search": [19, 25, 26, 27], "high": [19, 25, 26, 27], "100d": 19, "laptop": 19, "tl": [19, 24], "dr": [19, 24], "spoiler": 19, "alert": 19, "again": [19, 22], "consid": [19, 20, 23, 25, 27], "suit": [19, 20, 21, 27, 28], "h2mg": [19, 20], "g2mg": [19, 20], "batteri": [19, 20], "altogeth": 19, "fire": 19, "ve": 19, "discrep": 19, "seen": 19, "sipu": [19, 21, 27], "birch2": [19, 21], "01": [19, 20, 21, 24], "02": [19, 21, 24, 27], "35": [19, 21, 27], "44": [19, 21, 27], "43": [19, 21, 25], "worms_64": [19, 21, 27], "03": [19, 21, 27], "06": [19, 21], "08": [19, 21, 27], "34": [19, 21, 27], "wut": [19, 21], "trajectori": [19, 21], "noteworthi": 19, "wors": [19, 27], "although": 19, "recal": [19, 27], "interestingli": [19, 20], "outcom": [19, 20], "across": 19, "chose": 19, "median": [19, 20, 21, 27], "genie_0": [19, 20, 21, 27], "728": 19, "307": 19, "516": 19, "844": 19, "1_approx": 19, "755": 19, "292": 19, "555": 19, "3_approx": [19, 27], "568": 19, "731": 19, "332": 19, "531": 19, "5_approx": 19, "734": 19, "326": 19, "624": 19, "376": 19, "264": [19, 28], "719": [19, 27], "7_approx": 19, "genie_1": 19, "415": 19, "174": 19, "0_approx": 19, "409": 19, "45": [19, 21], "148": 19, "evalu": 20, "aggreg": [20, 21, 23, 28], "limit": [20, 27], "dg19": [20, 28], "fmiz16": [20, 28], "fs18": [20, 28], "gp10": [20, 28], "khk99": [20, 28], "ult05": [20, 28], "alongsid": 20, "studi": [20, 27, 28], "fastclust": [20, 27, 28], "mul13": [20, 27, 28], "maximis": 20, "em": 20, "mixtur": [20, 21], "spectral": 20, "itm": [20, 21, 28], "ha85": [20, 21, 28], "plausibl": 20, "dn09": [20, 28], "appendix": 20, "reason": [20, 23], "restrict": [20, 23], "ourselv": [20, 23], "000": [20, 27], "omit": 20, "popul": 20, "parametr": 20, "boxplot": 20, "empir": [20, 25], "lead": 20, "highest": 20, "former": 20, "grid": 20, "branching_factor": 20, "005": 20, "025": 20, "rbf": 20, "laplacian": 20, "poli": 20, "sigmoid": 20, "gamma": 20, "n_init": [20, 27], "subject": 20, "perhap": 20, "lesser": 20, "lower": 20, "birch_0": [20, 21], "12": [20, 21, 27, 28], "spectral_rbf_5": [20, 21], "70": [20, 27], "105": [20, 27], "600": [20, 27], "overal": [20, 27], "inspect": 20, "quit": 20, "sens": 20, "signific": 20, "present": 21, "fm83": [21, 28], "veb10": [21, 28], "wherev": 21, "38": [21, 27], "92": [21, 27], "54": [21, 27], "19": 21, "46": [21, 25, 27], "47": [21, 27], "78": [21, 28], "37": [21, 23, 27], "82": [21, 28], "98": [21, 24, 27], "31": 21, "88": [21, 27], "59": [21, 27], "76": [21, 27], "56": 21, "68": [21, 27, 28], "69": [21, 27], "99": [21, 24], "51": [21, 27], "89": [21, 25, 27], "33": [21, 27], "fcp": 21, "atom": 21, "chainlink": 21, "09": 21, "engytim": 21, "04": [21, 27], "hepta": 21, "lsun": 21, "target": 21, "tetra": 21, "twodiamond": 21, "wingnut": 21, "86": [21, 27], "grave": [21, 28], "81": [21, 27], "fuzzyx": 21, "93": [21, 27], "parabol": 21, "66": [21, 27], "62": [21, 27], "ring": 21, "ring_noisi": 21, "ring_outli": 21, "zigzag": 21, "zigzag_noisi": 21, "52": [21, 27], "zigzag_outli": 21, "chameleon_t4_8k": 21, "55": [21, 27], "61": 21, "chameleon_t5_8k": 21, "chameleon_t7_10k": 21, "chameleon_t8_8k": 21, "iris5": 21, "17": [21, 27, 28], "a1": 21, "94": 21, "a2": 21, "a3": 21, "compound": 21, "d31": 21, "flame": 21, "22": [21, 27], "pathbas": 21, "r15": 21, "s1": 21, "s2": 21, "67": [21, 27], "s4": 21, "spiral": 21, "unbal": 21, "uci": [21, 28], "ecoli": 21, "glass": 21, "24": [21, 27], "ionospher": 21, "sonar": 21, "statlog": 21, "wdbc": 21, "wine": 21, "yeast": 21, "circl": 21, "cross": 21, "07": [21, 27], "isol": 21, "labirynth": 21, "mk1": 21, "mk2": 21, "mk3": 21, "mk4": 21, "olymp": 21, "smile": 21, "stripe": 21, "trapped_lov": 21, "twosplash": 21, "window": 21, "x1": 21, "x2": 21, "x3": 21, "z1": 21, "z2": 21, "z3": 21, "58": [21, 27], "wise": 21, "heat": 21, "map": [21, 25, 28], "mnist": [21, 27], "fashion": [21, 27], "birch1": 21, "worms_2": [21, 27], "project": [22, 25, 28], "site": 22, "reveal": 22, "goal": 22, "light": 22, "grei": 22, "alpha": 22, "d_m": 22, "parameteris": 22, "eagerli": 22, "plai": 22, "natur": 22, "temporarili": 22, "did": 22, "step": 22, "identif": 22, "g1": 22, "labels_nois": 22, "non_nois": 22, "g2": 22, "old": [22, 25], "excel": 22, "still": [22, 27], "hood": 22, "ask": 22, "switch": 22, "finer": 22, "nc": 22, "min_sampl": 22, "closer": 22, "mcss": 22, "mss": 22, "neat": 22, "latest": 23, "repositori": [23, 28], "sustain": 23, "societi": 23, "human": 23, "environment": 23, "wellb": 23, "countri": 23, "seven": 23, "categori": [23, 24], "ssi": 23, "csv": [23, 25], "ssi_2016_categori": 23, "comment": 23, "char": 23, "everyth": 23, "1st": 23, "dimnam": 23, "head": [23, 25], "basicne": 23, "personaldevelopmentandhealth": 23, "wellbalancedsocieti": 23, "naturalresourc": 23, "climateandenergi": 23, "transit": 23, "economi": 23, "albania": 23, "605769": 23, "959609": 23, "992649": 23, "634251": 23, "621681": 23, "102542": 23, "056494": 23, "algeria": 23, "021185": 23, "336496": 23, "203906": 23, "277173": 23, "662674": 23, "074134": 23, "154272": 23, "angola": 23, "972848": 23, "692808": 23, "140138": 23, "759396": 23, "212197": 23, "898812": 23, "753476": 23, "argentina": 23, "831955": 23, "350592": 23, "895167": 23, "453451": 23, "300326": 23, "389867": 23, "340636": 23, "armenia": 23, "446943": 23, "420523": 23, "289224": 23, "436303": 23, "854317": 23, "434233": 23, "829620": 23, "australia": 23, "000000": 23, "590927": 23, "105539": 23, "130701": 23, "627805": 23, "539498": 23, "593052": 23, "workhors": 23, "yet": 23, "effici": [23, 27], "feed": 23, "glust": 23, "154": 23, "extract": [23, 25, 27], "bolivia": 23, "ghana": 23, "russia": 23, "ethiopia": 23, "zimbabw": 23, "yemen": 23, "mauritania": 23, "mauritiu": 23, "state": 23, "mexico": 23, "thailand": 23, "namibia": 23, "korea": 23, "north": 23, "chile": 23, "austria": 23, "ukrain": 23, "lebanon": 23, "libya": 23, "vietnam": 23, "nicaragua": 23, "romania": 23, "lao": 23, "cote": 23, "ivoir": 23, "panama": 23, "tunisia": 23, "alloc": 23, "depict": 23, "rworldmap": 23, "mapdata": 23, "joincountrydata2map": 23, "joincod": 23, "namejoincolumn": 23, "mapcountrydata": 23, "namecolumntoplot": 23, "catmethod": 23, "categor": 23, "missingcountrycol": 23, "white": 23, "colourpalett": 23, "r4": 23, "maptitl": 23, "067901": 23, "268879": 23, "817850": 23, "508130": 23, "931156": 23, "299537": 23, "886885": 23, "868176": 23, "827154": 23, "663252": 23, "004013": 23, "374348": 23, "624147": 23, "081801": 23, "594718": 23, "074894": 23, "630009": 23, "340152": 23, "512709": 23, "541081": 23, "274155": 23, "readabl": 23, "oecd": 23, "belgium": 23, "canada": 23, "colombia": 23, "czech": 23, "republ": 23, "denmark": 23, "estonia": 23, "finland": 23, "franc": 23, "germani": 23, "greec": 23, "hungari": 23, "iceland": 23, "ireland": 23, "israel": 23, "itali": 23, "japan": 23, "south": 23, "latvia": 23, "lithuania": 23, "luxembourg": 23, "netherland": 23, "zealand": 23, "norwai": 23, "poland": 23, "portug": 23, "slovak": 23, "slovenia": 23, "spain": 23, "sweden": 23, "switzerland": 23, "turkei": 23, "kingdom": 23, "x_oecd": 23, "h_oecd": 23, "final": 23, "interest": 23, "specif": [23, 24, 26], "slightli": [23, 27], "don": [23, 25], "forget": 23, "regard": 23, "There": 24, "websit": [24, 25], "characterist": 24, "re": [24, 27], "illustr": [24, 25], "game": [24, 25], "figur": 24, "bottom": 24, "standardscal": 24, "itertool": 24, "cycl": 24, "islic": 24, "seed": 24, "1234": 24, "1500": 24, "10000": [24, 27], "noisy_circl": 24, "make_circl": 24, "noisy_moon": 24, "make_moon": 24, "make_blob": 24, "random_st": 24, "no_structur": 24, "anisotrop": 24, "170": 24, "x_aniso": 24, "aniso": 24, "vari": 24, "cluster_std": 24, "figsiz": 24, "subplots_adjust": 24, "001": 24, "wspace": 24, "hspace": 24, "plot_num": 24, "default_bas": 24, "n_neighbor": 24, "i_dataset": 24, "algo_param": 24, "enumer": 24, "param": 24, "copi": 24, "easier": 24, "fit_transform": 24, "agglomerativeclust": 24, "clustering_algorithm": 24, "t0": [24, 27], "catch": 24, "relat": 24, "kneighbors_graph": 24, "catch_warn": 24, "filterwarn": 24, "avoid": 24, "stop": 24, "earli": 24, "userwarn": 24, "t1": 24, "hasattr": 24, "astyp": 24, "els": 24, "377eb8": 24, "ff7f00": 24, "4daf4a": 24, "f781bf": 24, "a65628": 24, "984ea3": 24, "999999": 24, "e41a1c": 24, "dede00": 24, "xtick": 24, "ytick": 24, "2f": 24, "lstrip": 24, "gca": 24, "transax": 24, "box": 24, "fastest": [24, 27], "ideal": 24, "next": 24, "challeng": 24, "handl": 25, "exercis": 25, "movielen": 25, "consecut": [25, 27], "read_csv": 25, "ml": [25, 28], "movieid": 25, "userid": 25, "old_movieid_map": 25, "searchsort": 25, "timestamp": 25, "964982703": 25, "964981247": 25, "964982224": 25, "964983815": 25, "964982931": 25, "metadata": 25, "loc": 25, "isin": 25, "iloc": 25, "stori": 25, "jumanji": 25, "grumpier": 25, "men": 25, "wait": 25, "exhal": 25, "father": 25, "bride": 25, "ii": 25, "convers": 25, "csr": 25, "dok_matrix": 25, "tocsr": 25, "repr": 25, "9724x610": 25, "100836": 25, "todens": 25, "200": 25, "film": 25, "which_clust": 25, "monti": 25, "life": 25, "1983": [25, 28], "sort_valu": 25, "2097": 25, "airplan": 25, "1980": 25, "2907": 25, "famou": 25, "2000": 25, "1914": 25, "analyz": 25, "1999": [25, 28], "969": 25, "futur": 25, "1486": 25, "1989": 25, "1487": 25, "iii": 25, "1990": 25, "2259": 25, "Being": 25, "john": 25, "malkovich": 25, "2916": 25, "921": 25, "brother": 25, "bottl": 25, "rocket": 25, "1996": [25, 28], "2084": 25, "bowfing": 25, "2190": 25, "boi": 25, "cry": 25, "2888": 25, "cell": 25, "832": 25, "door": 25, "1991": 25, "955": 25, "duck": 25, "soup": 25, "1933": 25, "836": 25, "terrestri": 25, "1982": 25, "1960": 25, "elect": 25, "2036": 25, "ey": 25, "wide": 25, "shut": 25, "819": 25, "fish": 25, "wanda": 25, "1988": 25, "1232": 25, "full": 25, "1997": 25, "964": 25, "groundhog": 25, "dai": 25, "1993": 25, "2605": 25, "fidel": 25, "1211": 25, "hunt": 25, "octob": 25, "2382": 25, "magnolia": 25, "863": 25, "holi": 25, "grail": 25, "1975": 25, "2094": 25, "And": 25, "someth": 25, "completel": 25, "820": 25, "brian": 25, "4581": 25, "2892": 25, "nake": 25, "gun": 25, "smell": 25, "fear": 25, "2891": 25, "polic": 25, "squad": 25, "3010": 25, "art": [25, 28], "thou": 25, "1394": 25, "sight": 25, "2443": 25, "patriot": 25, "1992": 25, "850": 25, "peopl": 25, "larri": 25, "flynt": 25, "899": 25, "princess": 25, "2020": [25, 28], "lola": 25, "rennt": 25, "1796": 25, "rushmor": 25, "star": 25, "war": 25, "episod": 25, "phantom": 25, "menac": 25, "iv": 25, "hope": 25, "1977": 25, "898": 25, "strike": 25, "911": [25, 27], "vi": 25, "jedi": 25, "934": 25, "sting": 25, "2030": 25, "summer": 25, "sam": 25, "987": 25, "spinal": 25, "tap": 25, "1984": 25, "2174": 25, "three": 25, "king": 25, "839": 25, "1986": 25, "3016": 25, "traffic": 25, "1113": 25, "guffman": 25, "977": 25, "young": 25, "frankenstein": 25, "abridg": 25, "databas": [25, 28], "889x283": 25, "228": 25, "753": 25, "444": 25, "zero": 25, "144": 25, "500": 25, "13327": 25, "blackadd": 25, "forth": 25, "13328": 25, "christma": 25, "carol": 25, "3341": 25, "creatur": 25, "comfort": 25, "1197": 25, "grand": 25, "wallac": 25, "gromit": 25, "2778": 25, "night": 25, "1964": 25, "2861": 25, "help": 25, "2963": 25, "won": 25, "1967": 25, "6006": 25, "live": 25, "hollywood": 25, "bowl": 25, "2703": 25, "1058": 25, "6698": 25, "27284": 25, "oliv": 25, "twist": 25, "2216": 25, "1968": 25, "4716": 25, "quadrophenia": 25, "6027": 25, "secret": 25, "policeman": 25, "27448": 25, "basket": 25, "2792": 25, "tommi": 25, "10475": 25, "curs": [25, 27], "rabb": 25, "732": 25, "close": 25, "shave": 25, "708": 25, "aardman": 25, "animatio": 25, "1125": 25, "wrong": 25, "trouser": 25, "13239": 25, "loaf": 25, "2772": 25, "yellow": 25, "submarin": 25, "1250": 25, "charact": 26, "levenshtein": 26, "edit": 26, "rmd": 26, "actg1": 26, "tolist": 26, "tmp": 26, "ipykernel_15571": 26, "1616393685": 26, "deprecationwarn": 26, "deprec": 26, "alia": 26, "builtin": 26, "silenc": 26, "modifi": 26, "behavior": 26, "safe": [26, 27], "scalar": 26, "str_": 26, "guidanc": 26, "devdoc": 26, "html": [26, 28], "tataacaaccctgattacatcaagctacgctccggtgcgttgcctcggacgagtgctaatccctccccactgactgtattcatcttgacaata": 26, "atgtctccaaagcgtgaccttctagacccgagacgacatatggaggcttggagccgtacctgtgtgaggaaactgtagtacccaaagctattca": 26, "gcaattgaagtccagatctaggtatcgtccaagcatattgcctttaagaaatatatttgaccctgtctcttcgtggaggtacacgtcacggaatcgtaagatttccttgg": 26, "gacaattatcgcggctttcgccatgcagagtctcgtacaatttgtttcacgcccaatattttccgtgcttcgcgagctaggcagccagggcatttttgga": 26, "ttagagcgcttaaccccacaggaaccgagttcccctcatgtggcaaggttctcccgcctcaggtatcacagaaacaaggtatgtagccctaggctacgagc": 26, "domain": 26, "convert": 26, "labels_pr": 26, "9352814722212013": 26, "crucial": 27, "question": 27, "resourc": 27, "restart": 27, "ols95": [27, 28], "cel": [27, 28], "mrg10": [27, 28], "automat": 27, "pc": 27, "linux": 27, "40": 27, "ubuntu": 27, "smp": 27, "x86_64": 27, "kernel": [27, 28], "intel": 27, "tm": 27, "i7": 27, "9750h": 27, "cpu": 27, "60ghz": 27, "12m": 27, "cach": 27, "242": 27, "084": 27, "kb": 27, "irrespect": 27, "1000": 27, "70000": 27, "412": 27, "fastcluster_centroid": 27, "4170": 27, "fastcluster_median": 27, "3927": 27, "fastcluster_ward": 27, "4114": 27, "sklearn_kmean": 27, "217": [27, 28], "1691": 27, "784": 27, "445": 27, "4486": 27, "4384": 27, "4757": 27, "225": 27, "1745": 27, "105600": 27, "60": 27, "111": 27, "105000": 27, "4945": 27, "778": 27, "357": 27, "degrad": 27, "choic": 27, "kmkm17": [27, 28], "importantli": 27, "slower": 27, "synthet": 27, "50000": 27, "100000": 27, "500000": 27, "1000000": 27, "158": 27, "202": 27, "113": 27, "266": 27, "3_mlpack": 27, "794": 27, "2014": 27, "3_nomlpack": 27, "267": 27, "1657": 27, "421": 27, "2997": 27, "4388": 27, "1627": 27, "7708": 27, "2175": 27, "11346": 27, "132": 27, "4408": 27, "16021": 27, "clearli": 27, "visibl": 27, "done": 27, "physic": 27, "evidenc": 27, "1m": 27, "pool": 27, "elaps": 27, "3f": 27, "set_param": 27, "028": 27, "public": 28, "pleas": 28, "buitinck": 28, "xperienc": 28, "ecml": 28, "pkdd": 28, "workshop": 28, "languag": 28, "108": 28, "122": 28, "polish": 28, "academi": 28, "dasgupta": 28, "ng": 28, "nip": 28, "toward": 28, "2009": 28, "url": 28, "clusteringtheori": 28, "dua": 28, "graff": 28, "archiv": 28, "edu": 28, "ester": 28, "kriegel": 28, "xu": 28, "kdd": 28, "page": 28, "226": 28, "231": 28, "american": 28, "associ": 28, "383": 28, "553": 28, "569": 28, "fr\u00e4nti": 28, "mariescu": 28, "istodor": 28, "zhong": 28, "xnn": 28, "10029": 28, "207": 28, "319": 28, "49055": 28, "7_19": 28, "sieranoja": 28, "six": 28, "4743": 28, "4759": 28, "s10489": 28, "018": 28, "1238": 28, "ast": 28, "zenodo": 28, "melbourn": 28, "isbn": 28, "6455719": 28, "datawranglingpi": 28, "5281": 28, "6451068": 28, "3815066": 28, "pedrycz": 28, "161": 28, "522": 28, "543": 28, "fss": 28, "021": 28, "bf01908075": 28, "law": 28, "dilemma": 28, "3776": 28, "2005": 28, "karypi": 28, "han": 28, "kumar": 28, "chameleon": 28, "ierarch": 28, "dynam": 28, "781637": 28, "kobren": 28, "monath": 28, "krishnamurthi": 28, "mccallum": 28, "23rd": 28, "255": 28, "2017": 28, "1145": 28, "3097983": 28, "3098079": 28, "ling": 28, "theori": 28, "341": 28, "159": 28, "164": 28, "uclidean": 28, "lgorithm": 28, "16th": 28, "612": 28, "1835804": 28, "1835882": 28, "mcinn": 28, "heali": 28, "astel": 28, "205": 28, "00205": 28, "m\u00fcller": 28, "nowozin": 28, "lampert": 28, "german": 28, "confer": 28, "recognit": 28, "2012": 28, "amuel": 28, "m\u00fcllner": 28, "18637": 28, "jss": 28, "v053": 28, "i09": 28, "pedregosa": 28, "achin": 28, "ython": 28, "2825": 28, "2830": 28, "2011": 28, "jmlr": 28, "v12": 28, "pedregosa11a": 28, "engin": 28, "ultsch": 28, "som": 28, "u": 28, "organ": 28, "ariant": 28, "v11": 28, "vinh10a": 28, "www": 28, "danifold": 28, "net": 28, "contrib": 28, "python_bind": 28}, "objects": {"genieclust": [[3, 0, 1, "", "Genie"], [1, 2, 0, "-", "cluster_validity"], [2, 2, 0, "-", "compare_partitions"], [4, 2, 0, "-", "inequity"], [5, 2, 0, "-", "internal"], [6, 2, 0, "-", "plots"], [7, 2, 0, "-", "tools"]], "genieclust.Genie": [[3, 1, 1, "", "fit"]], "genieclust.cluster_validity": [[1, 3, 1, "", "calinski_harabasz_index"], [1, 3, 1, "", "dunnowa_index"], [1, 3, 1, "", "generalised_dunn_index"], [1, 3, 1, "", "negated_ball_hall_index"], [1, 3, 1, "", "negated_davies_bouldin_index"], [1, 3, 1, "", "negated_wcss_index"], [1, 3, 1, "", "silhouette_index"], [1, 3, 1, "", "silhouette_w_index"], [1, 3, 1, "", "wcnn_index"]], "genieclust.compare_partitions": [[2, 3, 1, "", "adjusted_asymmetric_accuracy"], [2, 3, 1, "", "adjusted_fm_score"], [2, 3, 1, "", "adjusted_mi_score"], [2, 3, 1, "", "adjusted_rand_score"], [2, 3, 1, "", "compare_partitions"], [2, 3, 1, "", "compare_partitions2"], [2, 3, 1, "", "confusion_matrix"], [2, 3, 1, "", "fm_score"], [2, 3, 1, "", "mi_score"], [2, 3, 1, "", "normalize_confusion_matrix"], [2, 3, 1, "", "normalized_accuracy"], [2, 3, 1, "", "normalized_confusion_matrix"], [2, 3, 1, "", "normalized_mi_score"], [2, 3, 1, "", "normalizing_permutation"], [2, 3, 1, "", "pair_sets_index"], [2, 3, 1, "", "rand_score"]], "genieclust.inequity": [[4, 3, 1, "", "bonferroni_index"], [4, 3, 1, "", "devergottini_index"], [4, 3, 1, "", "gini_index"]], "genieclust.internal": [[5, 0, 1, "", "DisjointSets"], [5, 0, 1, "", "GiniDisjointSets"]], "genieclust.internal.DisjointSets": [[5, 1, 1, "", "find"], [5, 1, 1, "", "get_k"], [5, 1, 1, "", "get_n"], [5, 1, 1, "", "to_list"], [5, 1, 1, "", "to_list_normalized"], [5, 1, 1, "", "to_lists"], [5, 1, 1, "", "union"]], "genieclust.internal.GiniDisjointSets": [[5, 1, 1, "", "find"], [5, 1, 1, "", "get_count"], [5, 1, 1, "", "get_counts"], [5, 1, 1, "", "get_gini"], [5, 1, 1, "", "get_k"], [5, 1, 1, "", "get_n"], [5, 1, 1, "", "get_smallest_count"], [5, 1, 1, "", "to_list"], [5, 1, 1, "", "to_list_normalized"], [5, 1, 1, "", "to_lists"], [5, 1, 1, "", "union"]], "genieclust.plots": [[6, 3, 1, "", "plot_scatter"], [6, 3, 1, "", "plot_segments"]], "genieclust.tools": [[7, 3, 1, "", "argkmin"], [7, 3, 1, "", "cummax"], [7, 3, 1, "", "cummin"]]}, "objtypes": {"0": "py:class", "1": "py:method", "2": "py:module", "3": "py:function"}, "objnames": {"0": ["py", "class", "Python class"], "1": ["py", "method", "Python method"], "2": ["py", "module", "Python module"], "3": ["py", "function", "Python function"]}, "titleterms": {"python": [0, 8], "packag": [0, 8, 10, 15], "genieclust": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15], "refer": [0, 10, 11, 12, 13, 14, 16, 17, 28], "modul": 0, "class": 0, "cluster_valid": [1, 11], "compare_partit": [2, 12], "geni": [3, 14, 15], "inequ": [4, 16], "intern": [5, 11], "plot": 6, "tool": 7, "fast": [8, 27], "robust": 8, "hierarch": [8, 14, 15], "cluster": [8, 11, 12, 14, 15, 22], "nois": [8, 22], "point": [8, 22], "detect": [8, 22], "version": 8, "r": [8, 10, 23], "featur": 8, "contribut": 8, "exampl": [8, 11, 12, 14, 16, 17, 23, 25, 26], "tutori": 8, "api": 8, "document": 8, "see": [8, 11, 12, 13, 14, 15, 16, 17, 28], "also": [8, 11, 12, 13, 14, 15, 16, 17, 28], "appendix": 8, "what": 9, "i": [9, 20, 27], "new": 9, "1": 9, "2022": 9, "09": 9, "15": 9, "0": 9, "05": 9, "08": 9, "2021": 9, "04": 9, "22": 9, "9": 9, "8": 9, "01": 9, "4": 9, "2020": 9, "07": 9, "31": 9, "3": 9, "25": 9, "2": 9, "18": 9, "1a2": 9, "2018": 9, "23": 9, "valid": [11, 12], "measur": [11, 12, 16], "descript": [11, 12, 13, 14, 15, 16, 17], "usag": [11, 12, 13, 14, 16, 17], "argument": [11, 12, 13, 14, 16, 17], "valu": [11, 12, 13, 14, 16, 17], "author": [11, 12, 13, 14, 15, 16, 17], "": [11, 12, 13, 14, 15, 16, 17], "extern": 12, "pairwis": [12, 17], "partit": 12, "similar": 12, "score": 12, "detail": [12, 14, 16, 17, 21], "emst_mlpack": 13, "euclidean": 13, "minimum": [13, 17], "span": [13, 17], "tree": [13, 17], "gclust": 14, "algorithm": [14, 15, 24], "The": 15, "extra": 15, "mst": 17, "distanc": 17, "graph": 17, "basic": 18, "break": 18, "ic": 18, "A": [18, 22], "comparison": 18, "k": 18, "mean": 18, "hdbscan": [18, 22], "dendrogram": 18, "further": 18, "read": 18, "benchmark": [19, 20, 21], "approxim": 19, "method": 19, "how": [20, 27, 28], "good": 20, "It": [20, 27], "small": [20, 21], "dataset": [20, 21, 24, 27], "larg": [20, 21, 27], "summari": [20, 21, 27], "result": 21, "ar": 21, "fm": 21, "ami": 21, "nmi": 21, "nacc": 21, "psi": 21, "smooth": 22, "factor": 22, "comparis": 22, "interfac": 23, "compar": 24, "toi": 24, "spars": 25, "data": [25, 26], "movi": 25, "recommend": 25, "string": 26, "group": 26, "dna": 26, "time": 27, "function": 27, "n": 27, "d": 27, "number": 27, "thread": 27, "cite": 28, "bibliographi": 28}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 6, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinxcontrib.bibtex": 9, "sphinx.ext.todo": 2, "sphinx": 56}})
\ No newline at end of file
+Search.setIndex({"docnames": ["genieclust", "genieclust_cluster_validity", "genieclust_compare_partitions", "genieclust_genie", "genieclust_inequity", "genieclust_internal", "genieclust_plots", "genieclust_tools", "index", "news", "rapi", "rapi/cluster_validity", "rapi/compare_partitions", "rapi/emst_mlpack", "rapi/gclust", "rapi/genieclust-package", "rapi/inequity", "rapi/mst", "weave/basics", "weave/benchmarks_approx", "weave/benchmarks_ar", "weave/benchmarks_details", "weave/noise", "weave/r", "weave/sklearn_toy_example", "weave/sparse", "weave/string", "weave/timings", "z_bibliography"], "filenames": ["genieclust.rst", "genieclust_cluster_validity.rst", "genieclust_compare_partitions.rst", "genieclust_genie.rst", "genieclust_inequity.rst", "genieclust_internal.rst", "genieclust_plots.rst", "genieclust_tools.rst", "index.md", "news.md", "rapi.md", "rapi/cluster_validity.md", "rapi/compare_partitions.md", "rapi/emst_mlpack.md", "rapi/gclust.md", "rapi/genieclust-package.md", "rapi/inequity.md", "rapi/mst.md", "weave/basics.rst", "weave/benchmarks_approx.rst", "weave/benchmarks_ar.rst", "weave/benchmarks_details.rst", "weave/noise.rst", "weave/r.md", "weave/sklearn_toy_example.rst", "weave/sparse.rst", "weave/string.rst", "weave/timings.rst", "z_bibliography.rst"], "titles": ["Python Package <cite>genieclust</cite> Reference", "genieclust.cluster_validity", "genieclust.compare_partitions", "genieclust.Genie", "genieclust.inequity", "genieclust.internal", "genieclust.plots", "genieclust.tools", "<em>genieclust</em>: Fast and Robust Hierarchical Clustering with Noise Point Detection", "What Is New in <em>genieclust</em>", "R Package <em>genieclust</em> Reference", "cluster_validity: Internal Cluster Validity Measures", "compare_partitions: External Cluster Validity Measures and Pairwise Partition Similarity Scores", "emst_mlpack: Euclidean Minimum Spanning Tree", "gclust: Hierarchical Clustering Algorithm Genie", "genieclust-package: The Genie Hierarchical Clustering Algorithm (with Extras)", "inequity: Inequity (Inequality) Measures", "mst: Minimum Spanning Tree of the Pairwise Distance Graph", "Basics", "Benchmarks \u2014 Approximate Method", "Benchmarks (How Good Is It?)", "Benchmarks \u2014 Detailed Results", "Clustering with Noise Points Detection", "R Interface Examples", "Comparing Algorithms on Toy Datasets", "Example: Sparse Data and Movie Recommendation", "Example: String Data and Grouping of DNA", "Timings (How Fast Is It?)", "References"], "terms": {"geni": [0, 4, 5, 8, 10, 16, 17, 18, 19, 20, 22, 23, 24, 25, 26, 27, 28], "cluster_valid": [0, 9, 10], "compare_partit": [0, 9, 10, 18, 21, 26], "inequ": [0, 3, 8, 9, 10, 18], "intern": [0, 1, 6, 8, 9, 10], "plot": [0, 3, 8, 9, 14, 18, 22, 23, 24], "tool": [0, 3], "so": [1, 2, 3, 8, 9, 11, 12, 17, 18, 19, 21, 27], "call": [1, 2, 3, 5, 6, 8, 9, 11, 12, 14, 18, 23, 25, 27], "cluster": [1, 2, 3, 4, 5, 9, 10, 13, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28], "valid": [1, 2, 8, 9, 10, 14, 20, 23, 26, 28], "indic": [1, 2, 4, 6, 8, 9, 11, 16, 17, 18, 19, 21, 23, 26], "The": [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19, 20, 22, 23, 24, 25, 26, 27, 28], "greater": [1, 2, 3, 11, 23, 27], "index": [1, 2, 3, 4, 5, 7, 8, 11, 12, 14, 16, 18, 19, 20, 21, 23, 26], "valu": [1, 2, 3, 4, 5, 6, 7, 18, 24], "more": [1, 2, 3, 4, 7, 8, 9, 11, 15, 18, 20, 21, 22, 23, 26, 27], "whatev": [1, 11, 22], "mean": [1, 2, 3, 8, 11, 19, 20, 21, 22, 23, 25, 27, 28], "assess": [1, 11], "partit": [1, 2, 3, 5, 8, 10, 11, 14, 18, 20, 21, 22, 23, 24, 27, 28], "For": [1, 2, 3, 4, 5, 11, 12, 13, 16, 18, 19, 20, 22, 23, 27], "consist": [1, 11], "ball": [1, 8, 11, 25], "hall": [1, 8, 11], "davi": [1, 8, 11], "bouldin": [1, 8, 11], "take": [1, 3, 4, 11, 14, 16, 19, 25, 27], "neg": [1, 2, 4, 11, 12, 16], "These": [1, 2, 4, 12, 16], "measur": [1, 2, 4, 8, 9, 10, 14, 18, 21, 23, 28], "were": [1, 2, 9, 19, 21, 22, 25, 27], "critic": [1, 11], "review": [1, 2, 11, 12, 25, 28], "gagolewski": [1, 2, 3, 5, 8, 9, 11, 12, 13, 14, 15, 16, 17, 28], "bartoszuk": [1, 3, 5, 8, 9, 11, 14, 16, 28], "cena": [1, 3, 5, 8, 9, 11, 14, 16, 28], "2022": [1, 2, 11, 12, 28], "http": [1, 2, 3, 5, 9, 11, 12, 13, 14, 15, 16, 17, 18, 23, 26, 28], "doi": [1, 2, 3, 5, 9, 11, 12, 13, 14, 15, 16, 17, 28], "org": [1, 2, 5, 13, 26, 28], "10": [1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 27, 28], "1016": [1, 3, 5, 9, 11, 12, 13, 14, 15, 16, 17, 28], "j": [1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 14, 15, 16, 17, 22, 28], "ins": [1, 3, 5, 9, 11, 14, 16, 28], "2021": [1, 11, 12, 13, 14, 15, 16, 17, 28], "004": [1, 9, 11, 28], "preprint": [1, 2, 11, 12, 28], "see": [1, 2, 3, 5, 6, 9, 18, 19, 20, 21, 23, 26, 27], "section": [1, 11, 12, 18, 19, 20, 21, 27], "2": [1, 2, 3, 4, 6, 7, 8, 11, 12, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 27, 28], "therein": [1, 2, 11], "respect": [1, 2, 3, 6, 8, 9, 11, 12, 14, 17, 19, 21, 22, 25, 27], "definit": [1, 2, 8, 11, 12, 14, 18, 24, 25], "even": [1, 3, 4, 8, 22, 27], "detail": [1, 2, 3, 8, 9, 13, 15, 18, 20, 23, 26], "framework": [1, 2, 11, 12], "benchmark": [1, 2, 3, 8, 9, 11, 12, 14, 18, 23, 26, 27, 28], "algorithm": [1, 2, 3, 4, 5, 8, 9, 10, 11, 12, 13, 16, 17, 18, 19, 20, 21, 22, 25, 27, 28], "calinski_harabasz_index": [1, 9, 11], "x": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 22, 23, 24, 25, 27, 28], "y": [1, 2, 3, 5, 6, 11, 12, 13, 24, 28], "comput": [1, 2, 3, 4, 5, 8, 9, 11, 12, 14, 17, 18, 19, 23, 27, 28], "cali\u0144ski": [1, 8], "harabasz": [1, 8, 11], "3": [1, 2, 3, 4, 6, 7, 11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28], "1": [1, 2, 3, 4, 5, 6, 7, 11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28], "discuss": [1, 8, 9, 20, 27], "paramet": [1, 2, 3, 4, 5, 6, 7, 8, 9, 14, 18, 19, 20, 22, 24, 27], "c_contigu": [1, 2], "ndarrai": [1, 2, 3, 4, 5, 7], "shape": [1, 2, 3, 5, 6, 18, 22], "n": [1, 2, 3, 4, 5, 6, 7, 8, 11, 12, 14, 16, 17, 18, 22, 25, 28], "d": [1, 3, 8, 11, 12, 14, 17, 18, 22, 23, 25, 28], "data": [1, 2, 3, 4, 7, 8, 11, 12, 13, 14, 16, 17, 18, 22, 23, 24, 27, 28], "point": [1, 2, 3, 6, 11, 12, 14, 17, 18, 19, 20, 23, 27], "featur": [1, 3, 13, 14, 17, 18, 19, 21, 22, 23, 25, 27], "space": [1, 3, 9, 11, 13, 14, 17, 18, 19, 27, 28], "dimension": [1, 3, 9, 11, 13, 14, 17, 19, 27], "array_lik": [1, 2, 6], "A": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 25, 28], "vector": [1, 2, 3, 4, 5, 6, 7, 11, 12, 14, 16, 20], "small": [1, 2, 3, 7, 8, 14, 19, 25, 27], "integ": [1, 2, 3, 5, 6, 7, 11, 12, 14, 25], "repres": [1, 2, 5, 11, 12, 17], "input": [1, 2, 3, 8, 12, 14, 17, 18, 23, 25, 27], "i": [1, 2, 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 28], "id": [1, 3, 5, 11, 23, 25], "th": [1, 3, 5, 7, 11, 14, 17, 25], "where": [1, 2, 3, 4, 5, 6, 7, 11, 12, 14, 17, 19, 25], "0": [1, 2, 3, 4, 5, 6, 7, 12, 14, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28], "k": [1, 2, 3, 5, 6, 7, 8, 11, 12, 14, 16, 17, 20, 21, 23, 27, 28], "number": [1, 3, 4, 5, 8, 11, 14, 16, 17, 18, 20, 22, 23, 24], "return": [1, 2, 3, 4, 5, 7, 9, 12, 14, 22, 25], "float": [1, 3, 7, 14, 17], "dunnowa_index": [1, 9, 11], "generalis": [1, 8, 9, 11, 17], "dunn": [1, 8, 9, 11], "base": [1, 2, 3, 8, 9, 12, 13, 14, 17, 20, 21, 23, 25, 26, 27, 28], "neighbour": [1, 3, 8, 9, 11, 14, 17, 18, 19, 25, 26, 27], "owa": [1, 11], "oper": [1, 5, 11], "generalised_dunn_index": [1, 9, 11], "bezdek": [1, 11], "pal": [1, 11], "negated_ball_hall_index": [1, 9, 11], "negat": 1, "negated_davies_bouldin_index": [1, 9, 11], "negated_wcss_index": [1, 9, 11], "within": [1, 8, 11, 20], "sum": [1, 2, 11, 12], "squar": [1, 3, 11, 21], "us": [1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 20, 22, 23, 26, 27, 28], "object": [1, 3, 6, 12, 13, 14, 17, 18, 23, 24, 25], "function": [1, 2, 5, 6, 7, 8, 9, 12, 18], "ward": [1, 8, 20, 21, 24, 27], "silhouette_index": [1, 9, 11], "silhouett": [1, 8, 11], "averag": [1, 8, 11, 20, 21, 23, 24], "score": [1, 2, 4, 8, 10, 14, 16, 18, 20, 21, 23], "silhouette_w_index": [1, 9, 11], "w": [1, 3, 11, 13, 14, 28], "width": 1, "wcnn_index": [1, 9, 11], "refer": [1, 2, 3, 4, 8, 18, 19, 20, 21, 22, 23, 26, 27], "m": [1, 2, 3, 5, 6, 8, 9, 11, 12, 13, 14, 15, 16, 17, 22, 23, 28], "com": [1, 2, 3, 9, 11, 12, 13, 14, 15, 16, 17, 18, 23, 26, 28], "ar": [1, 2, 3, 4, 5, 6, 8, 9, 11, 12, 14, 16, 17, 18, 19, 20, 22, 23, 25, 27, 28], "inform": [1, 2, 3, 5, 8, 11, 12, 14, 16, 17, 20, 21, 28], "scienc": [1, 3, 5, 11, 14, 16, 17, 28], "581": [1, 11, 28], "620": [1, 11, 28], "636": [1, 11, 28], "calinski": [1, 11], "t": [1, 8, 11, 14, 18, 23, 25], "dendrit": [1, 11], "method": [1, 3, 8, 11, 12, 14, 17, 18, 20, 23, 24, 27, 28], "analysi": [1, 3, 11, 13, 17, 28], "commun": [1, 11], "statist": [1, 7, 11, 19, 20, 21, 28], "1974": [1, 11, 25], "27": [1, 7, 11, 21, 25, 27], "1080": [1, 11], "03610927408827101": [1, 11], "25": [1, 6, 19, 20, 21, 22, 23, 27], "owa_numer": [1, 11], "smin": [1, 11], "5": [1, 2, 3, 7, 11, 12, 13, 14, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27], "owa_denomin": [1, 11], "const": [1, 11], "int": [1, 3, 6, 7, 24, 25], "nearest": [1, 3, 8, 9, 11, 14, 17, 18, 19], "str": [1, 3, 26], "specifi": [1, 2, 11, 12, 28], "one": [1, 3, 4, 6, 7, 8, 11, 13, 14, 16, 17, 18, 19, 21, 22, 25, 26, 27], "min": [1, 2, 7, 11, 19, 20, 21], "max": [1, 2, 3, 6, 7, 11, 12, 14, 17, 19, 20, 21, 24, 25], "smax": [1, 11], "code": [1, 9], "an": [1, 2, 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 16, 17, 18, 22, 23, 25, 26, 27], "defin": [1, 2, 6, 11, 12, 17, 20], "degre": [1, 11, 26], "smooth": [1, 3, 8, 11, 14, 17], "lowercase_d": [1, 11], "uppercase_d": [1, 11], "between": [1, 2, 3, 7, 11, 12, 13, 14, 17, 18, 19, 20, 21, 22, 25, 26], "denot": [1, 3, 5, 11, 14, 18, 20, 21, 22], "d_1": [1, 11], "d_5": [1, 11], "numer": [1, 3, 4, 11, 12, 13, 14, 16, 17], "pairwis": [1, 2, 3, 8, 10, 11, 14, 27], "intraclust": [1, 11], "distanc": [1, 3, 8, 9, 10, 11, 14, 19, 21, 22, 23, 26, 27], "centroid": [1, 11, 20, 21, 27], "weight": [1, 3, 11, 14, 17], "d_3": [1, 11], "denomin": [1, 11], "some": [1, 2, 3, 5, 8, 9, 11, 12, 17, 20, 21, 27], "new": [1, 3, 5, 8, 11, 14, 16, 22, 23, 25, 28], "ieee": [1, 2, 11, 12, 28], "transact": [1, 2, 11, 12, 28], "system": [1, 3, 11, 27, 28], "man": [1, 11], "cybernet": [1, 11], "part": [1, 2, 3, 11, 12, 20, 25, 27], "b": [1, 3, 4, 8, 11, 13, 14, 16, 17, 18, 28], "28": [1, 2, 11, 12, 21, 27, 28], "1998": [1, 11, 25], "301": [1, 11], "315": [1, 11], "1109": [1, 2, 11, 28], "3477": [1, 11], "678624": [1, 11], "g": [1, 2, 3, 4, 5, 8, 11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 25, 26, 27, 28], "h": [1, 4, 8, 11, 14, 16, 18, 22, 23, 28], "isodata": [1, 11], "novel": [1, 11], "pattern": [1, 11, 28], "classif": [1, 2, 11, 12, 21, 28], "technic": [1, 11], "report": [1, 11, 20], "No": [1, 4, 11], "ad699616": [1, 11], "stanford": [1, 11], "research": [1, 2, 11, 12, 28], "institut": [1, 11, 28], "1965": [1, 11, 25], "l": [1, 2, 3, 6, 11, 12, 28], "separ": [1, 11, 17], "machin": [1, 2, 3, 11, 12, 13, 28], "intellig": [1, 11, 28], "pami": [1, 11], "1979": [1, 11, 25], "224": [1, 11, 25], "227": [1, 11], "tpami": [1, 11], "4766909": [1, 11], "rousseeuw": [1, 11], "p": [1, 2, 3, 11, 12, 13, 17, 18, 20, 27, 28], "graphic": [1, 6, 11, 18], "aid": [1, 11], "interpret": [1, 11], "appli": [1, 3, 9, 11, 14, 18, 20, 22, 27, 28], "mathemat": [1, 11], "20": [1, 2, 11, 12, 19, 20, 21, 26, 27, 28], "1987": [1, 11, 25], "53": [1, 11, 21, 25, 28], "65": [1, 2, 4, 11, 21, 27], "0377": [1, 11], "0427": [1, 11], "87": [1, 11, 21, 27], "90125": [1, 11], "7": [1, 3, 4, 7, 9, 11, 16, 19, 20, 21, 22, 23, 27, 28], "extern": [2, 8, 10, 14, 23, 26, 28], "similar": [2, 8, 10, 14, 18, 19, 20, 21, 23, 25, 26], "can": [2, 3, 4, 6, 8, 9, 12, 14, 16, 17, 18, 21, 22, 23, 26, 27], "compar": [2, 8, 12, 18, 27, 28], "output": [2, 3, 8, 12, 18, 19, 20, 24], "ground": [2, 12, 20], "truth": [2, 12, 20], "label": [2, 3, 6, 8, 11, 12, 17, 18, 20, 22, 26], "adjusted_asymmetric_accuraci": [2, 9, 12], "adjust": [2, 8, 12, 18, 19, 20, 21, 23, 26, 28], "asymmetr": [2, 8, 12, 28], "accuraci": [2, 8, 12, 21, 28], "aaa": 2, "two": [2, 3, 6, 12, 18, 25, 27, 28], "ident": [2, 12, 27], "length": [2, 3, 5, 6, 7, 12], "same": [2, 5, 6, 9, 12, 18, 20, 25, 27], "set": [2, 3, 4, 5, 6, 8, 12, 14, 16, 17, 18, 20, 21, 22, 23, 24, 26, 27, 28], "whose": [2, 3, 5, 7, 11, 14], "qualiti": [2, 11, 18, 20, 27], "we": [2, 3, 8, 11, 12, 14, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27], "would": [2, 18, 25], "like": [2, 3, 7, 8, 9, 13, 14, 17, 18, 27], "ass": 2, "doubl": [2, 4, 7], "multipl": [2, 17, 20, 28], "confus": [2, 9, 12, 18], "matrix": [2, 3, 6, 11, 12, 13, 14, 17, 18, 23, 24, 25, 26], "compare_partitions2": 2, "normalized_confusion_matrix": [2, 9, 12, 18], "determin": [2, 3, 8, 9, 12, 17, 25, 27], "permut": [2, 4, 12, 16], "row": [2, 3, 9, 11, 12, 17, 21, 23, 25], "column": [2, 3, 6, 9, 11, 12, 13, 14, 17, 21, 23], "element": [2, 3, 4, 5, 7, 12, 14, 16, 25], "main": [2, 12], "diagon": [2, 12], "largest": [2, 12], "possibl": [2, 12, 18, 23, 24], "note": [2, 3, 4, 5, 6, 7, 8, 12, 14, 17, 18, 19, 23, 24, 26, 27, 28], "let": [2, 5, 18, 19, 22, 23, 25, 26, 27], "c": [2, 3, 4, 8, 9, 11, 12, 14, 16, 17, 23, 28], "It": [2, 3, 7, 8, 12, 13, 14, 17, 18, 22, 24, 26], "correct": [2, 3, 12, 14, 28], "chanc": [2, 12, 28], "summari": [2, 8, 12], "proport": [2, 12], "correctli": [2, 12], "classifi": [2, 12, 22], "each": [2, 3, 5, 6, 8, 12, 14, 17, 19, 20, 21, 22, 23, 27], "match": [2, 8, 12, 18, 21, 28], "solut": [2, 3, 11, 12, 20], "maxim": [2, 9, 12, 20], "linear": [2, 12], "assign": [2, 4, 6, 8, 9, 12, 16, 18, 26], "problem": [2, 8, 9, 12, 27], "normalize_confusion_matrix": 2, "given": [2, 3, 4, 5, 12, 14, 16, 17, 18, 25, 27], "max_": [2, 12], "sigma": [2, 4, 12, 16], "sum_": [2, 4, 5, 12, 16], "c_": [2, 12], "miss": [2, 9, 14], "treat": [2, 3, 9], "thei": [2, 3, 4, 9, 16, 19, 20, 25, 27], "fill": [2, 9], "thi": [2, 3, 5, 6, 9, 12, 14, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27], "symmetr": [2, 12], "e": [2, 3, 4, 5, 8, 12, 13, 14, 16, 17, 18, 19, 20, 23, 25, 28], "doe": [2, 3, 14, 19, 27], "have": [2, 4, 5, 16, 19, 20, 21, 22, 27], "equal": [2, 4, 6, 7, 16, 18, 20, 22], "well": [2, 3, 6, 11, 12, 17, 18, 20, 28], "behav": [2, 12, 19, 28], "under": [2, 8, 12, 22, 28], "48550": [2, 12, 28], "arxiv": [2, 12, 28], "2209": [2, 12, 28], "02935": [2, 12, 28], "adjusted_fm_scor": [2, 12], "fowlk": [2, 8, 12, 21, 28], "mallow": [2, 8, 12, 21, 28], "adjusted_mi_scor": [2, 12], "mutual": [2, 3, 8, 9, 12, 14, 17, 21, 22], "mathrm": 2, "ami": 2, "_": 2, "adjusted_rand_scor": [2, 12, 14, 18, 26], "rand": [2, 8, 12, 18, 19, 20, 21, 23, 24, 26], "seri": [2, 27], "conting": 2, "tabl": [2, 12, 25], "dict": [2, 3, 26], "dictionari": [2, 3], "follow": [2, 4, 16, 18], "kei": 2, "r": [2, 3, 6, 9, 13, 14, 17, 27, 28], "unadjust": [2, 8, 12], "afm": 2, "fm": [2, 8, 12], "mi": [2, 8], "nmi": 2, "normalis": [2, 4, 5, 8, 16, 21], "nacc": 2, "psi": [2, 8, 12], "pair": [2, 6, 8, 12, 21, 23], "spsi": 2, "simplifi": [2, 9, 12], "assum": [2, 3, 12], "confusion_matrix": 2, "wrapper": 2, "around": 2, "accept": [2, 3, 9, 12, 17], "normalized_accuraci": [2, 9, 12], "pair_sets_index": [2, 9, 12, 14], "rand_scor": [2, 12], "fm_score": [2, 12], "mi_scor": [2, 12], "normalized_mi_scor": [2, 12], "nonempti": [2, 12], "disjoint": [2, 5, 6, 8, 12], "subset": [2, 5, 12], "instanc": [2, 3, 12, 27], "dataset": [2, 3, 8, 12, 14, 17, 18, 19, 22, 23, 25, 26, 28], "observ": [2, 3, 12, 17, 19, 20, 25, 27], "moreov": [2, 3, 17, 20, 22, 27], "correspond": [2, 3, 6, 14, 17, 18, 19, 22], "also": [2, 18, 20, 22, 23, 24, 25, 26, 27], "implement": [2, 3, 5, 8, 9, 11, 13, 16, 17, 18, 20, 21, 22, 25, 26, 27], "few": [2, 3, 18, 20, 23, 25, 27], "aim": 2, "quantifi": [2, 3, 4, 12, 16, 19, 20], "except": [2, 5, 12, 19, 23, 27], "act": [2, 3, 8, 12, 14], "which": [2, 3, 8, 9, 12, 14, 17, 18, 19, 20, 21, 22, 25, 27], "alwai": [2, 5, 6, 12], "up": [2, 3, 12, 14, 17, 20, 24, 27], "biject": [2, 12], "4": [2, 3, 6, 7, 11, 12, 14, 17, 18, 20, 21, 23, 24, 25, 27], "version": [2, 3, 9, 12, 14, 18, 19, 20, 21, 25, 27, 28], "sometim": [2, 3, 8, 12, 20], "rate": [2, 12, 21, 25], "pivot": [2, 9, 12, 18], "give": [2, 3, 4, 6, 12, 14, 16, 17, 18, 20, 23, 26, 27], "transform": [2, 12, 24, 25], "Its": [2, 3, 8, 11, 12, 14, 18], "eq": [2, 12], "instead": [2, 3, 9, 12, 14, 17, 18], "18": [2, 12, 19, 21, 24, 27, 28], "probabl": [2, 12, 28], "agreement": [2, 12, 20, 21], "its": [2, 3, 5, 6, 8, 12, 14, 18, 27], "especi": 2, "expect": [2, 6, 12, 20], "independ": [2, 3, 12], "due": [2, 12], "result": [2, 3, 5, 8, 9, 12, 14, 18, 19, 20, 22, 24, 27], "might": [2, 3, 7, 12, 14, 17, 18, 20, 22, 27], "similarli": [2, 12], "both": [2, 3, 12], "bound": [2, 12], "from": [2, 3, 4, 6, 8, 9, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 27, 28], "below": [2, 3, 9, 12, 20, 23, 24, 28], "henc": [2, 3, 12, 14, 20, 27], "prefer": [2, 7, 12], "theoret": [2, 8, 12, 20, 28], "hubert": [2, 12, 28], "arabi": [2, 12, 28], "journal": [2, 3, 11, 12, 13, 28], "1985": [2, 12, 25, 28], "193": [2, 12, 28], "218": [2, 12, 28], "rezaei": [2, 12, 28], "franti": [2, 12], "knowledg": [2, 12, 28], "mine": [2, 12, 24, 28], "8": [2, 3, 5, 7, 12, 14, 16, 18, 20, 21, 22, 23, 24, 27, 28], "2016": [2, 3, 5, 12, 14, 16, 28], "2173": [2, 12, 28], "2186": [2, 12, 28], "tkde": [2, 28], "2551240": [2, 28], "vinh": [2, 12, 28], "epp": [2, 12, 28], "bailei": [2, 12, 28], "comparison": [2, 8, 12, 28], "variant": [2, 12, 18, 27], "properti": [2, 3, 6, 12, 14, 28], "normal": [2, 12, 24, 28], "learn": [2, 3, 8, 12, 13, 18, 20, 24, 27, 28], "11": [2, 12, 18, 19, 20, 21, 27, 28], "2010": [2, 3, 12, 13, 28], "2837": [2, 12, 28], "2854": [2, 12, 27, 28], "exampl": [2, 4, 6, 7, 18, 22, 24], "np": [2, 4, 6, 7, 18, 22, 24, 25, 26, 27], "r_": [2, 4, 6, 7], "arrai": [2, 3, 5, 7, 18, 24], "round": [2, 4, 20], "v": [2, 16, 17, 25, 28], "item": [2, 21], "49": [2, 21], "74": [2, 21, 27], "73": [2, 20, 21], "29": [2, 12, 19, 21, 27], "41": [2, 21], "39": [2, 21], "71": [2, 21, 27], "63": [2, 17, 21], "underli": 2, "dens": [2, 3, 21, 25], "6": [2, 3, 4, 7, 16, 17, 20, 21, 22, 23, 24, 27], "origin": [2, 3, 8, 9, 14, 17, 18, 19, 22, 24, 27], "solv": [2, 8, 9, 12, 27], "count": [2, 18, 19, 20, 21], "than": [2, 3, 5, 8, 9, 19, 23, 27], "normalizing_permut": [2, 9, 12], "order": [2, 3, 4, 5, 7, 14, 16, 23, 27], "come": [2, 18, 26], "handi": 2, "when": [2, 3, 22, 28], "summaris": [2, 18, 21], "gener": [2, 3, 5, 7, 9, 14, 18, 19, 20, 24, 27], "actual": [2, 3], "do": [2, 3, 5, 26, 27], "matter": [2, 6, 25], "remap": 2, "chang": [2, 3, 20, 27], "use_sum": 2, "bool": [2, 3, 4], "whether": [2, 3, 12, 13, 14, 17], "should": [2, 3, 14, 18, 20], "class": [3, 5, 13, 14, 17, 18, 25], "n_cluster": [3, 8, 18, 20, 22, 24, 25, 26, 27], "gini_threshold": [3, 14, 18, 19, 20, 22, 23, 27], "affin": [3, 20, 25, 26], "l2": [3, 14, 17], "exact": [3, 19, 25, 26, 27], "true": [3, 11, 12, 14, 17, 18, 22, 26, 27], "compute_full_tre": [3, 18], "fals": [3, 4, 12, 13, 14, 17, 18, 19, 25, 26, 27], "compute_all_cut": 3, "postprocess": [3, 14], "boundari": [3, 14, 17], "cast_float32": [3, 14, 17, 23, 26], "mlpack_en": [3, 27], "auto": [3, 27], "mlpack_leaf_s": 3, "nmslib_n_neighbor": 3, "64": [3, 14, 17, 21, 27], "nmslib_params_init": 3, "hnsw": 3, "nmslib_params_index": [3, 26], "post": [3, 26], "nmslib_params_queri": 3, "verbos": [3, 13, 14, 17, 23], "hierarch": [3, 5, 9, 10, 11, 12, 13, 16, 17, 18, 20, 22, 23, 24, 27, 28], "detect": [3, 11, 14, 23, 27], "If": [3, 5, 6, 14, 17, 18, 23, 26], "all": [3, 4, 5, 6, 14, 16, 17, 19, 20, 21, 24, 27], "nois": [3, 14, 17, 18, 19, 21, 23, 24, 27, 28], "outlier": [3, 5, 8, 14, 16, 28], "detector": [3, 8, 14], "approxim": [3, 8, 9, 25, 27], "fail": [3, 20], "coarsest": 3, "grain": 3, "case": [3, 5, 6, 14, 17, 19, 21, 27], "warn": [3, 24, 26], "threshold": [3, 14, 18, 20], "gini": [3, 4, 5, 8, 14, 16, 18], "size": [3, 4, 5, 8, 13, 14, 16, 17, 18, 24, 27], "distribut": [3, 5, 8, 14, 20, 24], "low": [3, 9, 13, 14, 17, 27], "highli": [3, 8, 14, 27], "penalis": [3, 14], "format": [3, 8, 14, 25], "disabl": [3, 14, 22], "make": [3, 8, 14, 17, 18, 25, 26], "equival": [3, 6], "singl": [3, 8, 11, 12, 14, 19, 20, 21, 24, 27, 28], "linkag": [3, 8, 14, 17, 19, 20, 21, 24, 27], "tend": [3, 20, 22], "stabl": [3, 18, 20, 23, 28], "affect": [3, 18, 20], "usual": 3, "worth": [3, 8, 14, 18, 20, 24], "try": [3, 8, 14, 20, 24], "factor": [3, 8, 14, 17, 24], "reachabl": [3, 8, 9, 14, 17, 22], "chosen": [3, 14, 17], "need": [3, 5, 27], "addition": 3, "o": [3, 4, 5, 7, 9, 14, 16, 17, 25, 27], "work": [3, 7], "memori": [3, 7, 8, 13, 17, 27], "store": [3, 25, 27], "metric": [3, 13, 14, 17, 18, 26, 27, 28], "One": [3, 4], "synonym": [3, 14, 17], "euclidean": [3, 6, 9, 10, 14, 17, 19, 21, 22, 23, 27], "l1": [3, 14, 17], "manhattan": [3, 14, 17], "cityblock": [3, 14, 17], "cosinesimil": 3, "cosin": [3, 14, 17, 25], "precomput": 3, "In": [3, 6, 7, 9, 18, 19, 20, 21, 23, 27, 28], "latter": [3, 6, 20], "argument": [3, 6], "fit": [3, 8, 18, 20, 24, 25, 27], "must": [3, 5, 6], "form": [3, 8, 25], "scipi": [3, 6, 18, 25], "spatial": [3, 6, 28], "pdist": 3, "ani": [3, 6, 8, 22, 26, 27], "dissimilar": 3, "support": [3, 8, 9, 25], "nmslib": [3, 8, 9, 19, 25, 26, 27, 28], "github": [3, 8, 9, 14, 18, 23, 26, 28], "blob": [3, 24, 27, 28], "master": [3, 11, 18, 23, 26, 28], "manual": [3, 11, 12, 13, 14, 15, 16, 17, 18, 23, 28], "md": 3, "l2_spars": 3, "l1_spars": 3, "linf": 3, "linf_spars": 3, "cosinesimil_spars": [3, 25], "negdotprod": 3, "negdotprod_spars": 3, "angulardist": 3, "angulardist_spars": 3, "leven": [3, 26], "normleven": 3, "jaccard_spars": 3, "bit_jaccard": 3, "bit_ham": 3, "minimum": [3, 6, 7, 9, 10, 14, 20, 22, 27, 28], "span": [3, 6, 8, 9, 10, 14, 20, 22, 27, 28], "tree": [3, 6, 8, 9, 10, 14, 18, 20, 22, 23, 24, 26, 27, 28], "exactli": 3, "rather": 3, "estim": [3, 14, 17, 28], "graph": [3, 8, 9, 10, 14, 21, 27, 28], "ha": [3, 4, 9, 16, 21, 23, 27], "time": [3, 4, 5, 7, 8, 9, 13, 14, 16, 17, 20, 23, 24], "complex": [3, 4, 16, 17, 27], "howev": [3, 8, 14, 18, 20, 27], "onli": [3, 6, 8, 9, 12, 14, 18, 19, 20, 23, 24, 25, 27], "found": [3, 21, 22], "typic": [3, 20], "veri": [3, 7, 8, 13, 14, 17, 26, 27], "fast": [3, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 19, 22, 28], "requir": [3, 9], "whole": [3, 8, 14, 25], "hierarchi": [3, 8, 14, 18, 25, 27], "avail": [3, 8, 9, 13, 20, 23, 27], "enabl": 3, "dendrogram": [3, 8, 14, 23], "cut": 3, "arbitrari": [3, 14], "level": [3, 14, 27], "children_": [3, 18], "distances_": [3, 18], "counts_": [3, 18], "attribut": [3, 17], "request": [3, 17, 27], "coarser": [3, 22], "ones": [3, 19, 22], "labels_": [3, 24], "none": [3, 6, 14, 24], "control": [3, 13, 14, 17, 22], "treatment": 3, "after": [3, 8], "identifi": [3, 14, 17, 22, 23], "effect": [3, 14, 22, 27], "leaf": 3, "amongst": [3, 4, 14, 16, 18, 27], "adjac": [3, 14], "vertex": [3, 14], "": [3, 8, 18, 19, 20, 22, 23, 24, 25, 26, 27, 28], "By": [3, 14, 22, 27], "default": [3, 9, 14, 17, 18, 20, 22, 23, 27], "merg": [3, 5, 8, 14, 18], "core": [3, 8, 9, 14, 27], "To": [3, 8, 14, 18, 25, 26], "forc": [3, 14], "classic": [3, 8, 14], "notion": [3, 14, 18], "choos": [3, 14], "furthermor": 3, "leav": [3, 13, 14], "includ": [3, 8, 20], "cast": 3, "type": [3, 7, 25, 26], "float32": [3, 25], "perform": [3, 14, 19, 21, 25, 26, 27], "decreas": [3, 4, 16], "run": [3, 5, 7, 14, 19, 24, 25, 27], "ca": 3, "cost": [3, 5], "otherwis": [3, 5, 11, 14, 16, 17], "anywai": 3, "spars": [3, 8], "user": [3, 18, 22, 25, 28], "assur": 3, "themself": 3, "mlpack": [3, 9, 13, 27, 28], "emst": [3, 13, 27], "jarn\u00edk": [3, 27], "prim": [3, 9, 13, 17, 27], "often": [3, 8, 14], "As": [3, 19, 20], "name": [3, 17, 23, 24, 25], "suggest": [3, 9, 20], "reli": [3, 5, 18, 19, 22, 25, 26], "instal": [3, 8, 18, 23, 25, 26], "n_featur": 3, "kd": [3, 13], "accord": [3, 14], "best": [3, 8, 14, 20, 21, 25], "too": [3, 17, 18], "disconnect": [3, 8], "obtain": [3, 14, 18, 22, 23, 26], "less": [3, 19, 27], "pass": [3, 6, 14, 17], "init": 3, "io": 3, "data_typ": 3, "dtype": [3, 18, 22, 25, 26], "createindex": 3, "construct": 3, "indexthreadqti": 3, "omp_num_thread": [3, 14, 17], "environ": [3, 8, 14, 17], "variabl": [3, 14, 17, 20], "setquerytimeparam": 3, "print": [3, 13, 14, 17, 23, 25, 26, 27], "diagnost": [3, 13, 14, 17], "messag": [3, 13, 14, 17, 24], "progress": [3, 14, 17], "stderr": 3, "robust": [3, 9, 11, 12, 13, 14, 15, 16, 17, 28], "resist": [3, 5, 8, 14, 16, 28], "publish": 3, "packag": [3, 5, 6, 9, 13, 18, 20, 21, 22, 23, 25, 26, 27], "other": [3, 4, 5, 8, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 25, 27, 28], "much": [3, 8, 9, 18, 19, 20, 27], "faster": [3, 8, 9, 14, 17, 19, 23, 26, 27], "now": [3, 9, 14, 22, 25, 27], "option": [3, 9, 25, 26], "mst": [3, 6, 8, 10, 13, 14, 23, 27, 28], "just": [3, 14, 27], "consum": [3, 14], "edg": [3, 14, 17], "increas": [3, 14, 18, 27], "prevent": [3, 8, 14], "imbalanc": [3, 8, 14], "onc": [3, 6, 14, 22, 27], "rais": [3, 14], "abov": [3, 14, 18, 21, 25], "group": [3, 8, 14, 18, 21, 23], "smallest": [3, 5, 7, 8, 14, 18], "appeal": [3, 8, 14], "simplic": [3, 6, 8, 14], "goe": [3, 8, 14], "hand": [3, 8, 14, 18, 27], "usabl": [3, 8, 14], "outperform": [3, 8, 14, 18, 20], "approach": [3, 8, 14, 28], "itself": [3, 5, 26, 27], "sqrt": [3, 5, 14, 27], "provid": [3, 13, 14, 20, 22, 27], "our": [3, 9, 19, 22, 25, 27], "parallelis": [3, 9, 13, 14, 17, 27], "dijkstra": [3, 17, 27], "altern": [3, 14, 17, 27], "kruskal": [3, 27], "albeit": [3, 27], "sort": [3, 4, 7, 16, 17, 27], "forest": [3, 27], "structur": [3, 8, 27], "turn": [3, 18, 24, 27], "out": [3, 8, 18, 23, 24, 25, 27], "suitabl": [3, 27], "task": [3, 8, 17, 27], "connect": [3, 17, 24], "compon": [3, 24], "top": [3, 24, 25, 27], "depend": [3, 8, 9, 14, 25, 26, 27], "sure": [3, 25, 26], "your": [3, 8, 17, 24], "togeth": [3, 14, 18], "robustifi": [3, 8, 14, 18], "hdbscan": [3, 8, 9, 14, 21, 28], "contrari": [3, 22], "predecessor": [3, 8], "abl": [3, 8, 14, 18], "predefin": [3, 8, 14], "dbscan": [3, 8, 14, 18], "somewhat": [3, 8, 14, 18], "magic": [3, 14, 18], "ep": [3, 8, 14, 18], "min_cluster_s": [3, 14, 18, 22], "formal": 3, "raw": [3, 11, 14, 17, 21], "hold": [3, 4, 7, 14, 17], "being": [3, 5, 8, 14, 17], "pull": [3, 14, 17], "awai": [3, 4, 14, 16, 17], "dure": [3, 5], "procedur": [3, 22, 24], "process": [3, 11], "mai": [3, 8], "stage": [3, 21], "left": [3, 4, 16, 18, 24], "mark": [3, 14], "thread": [3, 8, 14, 17], "363": [3, 5, 14, 16, 28], "23": [3, 5, 14, 16, 19, 21, 27, 28], "05": [3, 5, 14, 16, 19, 20, 21, 24, 27, 28], "003": [3, 5, 14, 16, 28], "olson": [3, 17, 28], "f": [3, 17, 28], "parallel": [3, 17, 28], "21": [3, 17, 21, 27, 28], "1995": [3, 17, 25, 28], "1313": [3, 17, 28], "1325": [3, 17, 28], "0167": [3, 28], "8191": [3, 28], "95": [3, 21, 27, 28], "00017": [3, 28], "curtin": [3, 13, 28], "edel": [3, 13, 28], "lozhnikov": [3, 13, 28], "mentekidi": [3, 13, 28], "ghaisa": [3, 13, 28], "zhang": [3, 13, 28], "flexibl": [3, 13, 28], "librari": [3, 8, 13, 14, 17, 18, 23, 28], "open": [3, 8, 13, 18, 28], "sourc": [3, 8, 13, 20, 28], "softwar": [3, 13, 28], "26": [3, 7, 13, 21, 27, 28], "726": [3, 13, 28], "2018": [3, 13, 25, 28], "21105": [3, 28], "joss": [3, 28], "00726": [3, 28], "march": [3, 13, 28], "ram": [3, 13, 25, 28], "grai": [3, 13, 18, 28], "applic": [3, 4, 13, 16, 21, 28], "proc": [3, 13, 28], "acm": [3, 13, 28], "sigkdd": [3, 13, 28], "603": [3, 13, 28], "611": [3, 13], "naidan": [3, 28], "boytsov": [3, 28], "malkov": [3, 28], "novak": [3, 28], "non": [3, 4, 11, 16, 22, 25, 28], "2019": [3, 28], "latex": [3, 28], "pdf": [3, 6, 11, 13, 28], "campello": [3, 14, 17, 28], "moulavi": [3, 14, 17, 28], "sander": [3, 14, 17, 28], "densiti": [3, 14, 17, 28], "lectur": [3, 14, 17, 28], "7819": [3, 14, 17, 28], "2013": [3, 14, 17, 28], "160": [3, 14, 17, 28], "172": [3, 14, 17, 28], "1007": [3, 14, 17, 28], "978": [3, 14, 17, 28], "642": [3, 14, 17, 28], "37456": [3, 14, 17, 28], "2_14": [3, 14, 17, 28], "n_clusters_": 3, "unless": [3, 27], "taken": 3, "care": 3, "cardin": [3, 5, 27], "down": 3, "distinguish": 3, "conduct": 3, "fine": 3, "larger": [3, 20, 24, 27], "argu": 3, "yield": [3, 4, 16, 19, 25], "mani": [3, 18, 22], "n_samples_": 3, "n_features_": 3, "iter": 3, "descript": [3, 9, 19, 20], "z": 3, "constitut": 3, "guarante": 3, "increasingli": [3, 4, 7, 16], "violat": [3, 14], "ultrametr": [3, 14], "cummin": [3, 7, 14], "creat": [3, 24], "n_sampl": [3, 24], "ignor": [3, 24], "self": [3, 28], "wa": [3, 6, 9, 19, 20, 24, 25, 27], "either": [3, 6, 17], "squareform": 3, "real": 3, "numpi": [3, 9, 18, 22, 24, 25, 26, 27], "coercibl": [3, 12, 13, 14, 17], "good": [3, 8, 11, 19, 22, 27], "idea": [3, 8, 22], "standardis": [3, 14], "least": [3, 19, 20, 22, 27], "somehow": 3, "preprocess": [3, 21, 24], "coordin": [3, 6, 27], "axi": [3, 6, 9, 18, 22], "std": [3, 19, 20, 21], "ddof": 3, "centr": [3, 19, 21, 27], "total": [3, 4, 19, 21, 27], "varianc": [3, 19, 21, 24, 27], "wai": [3, 6, 20, 22, 25], "becom": [3, 27], "translat": [3, 27], "scale": [3, 19, 20, 21, 23, 27], "invari": 3, "what": [3, 8, 22], "record": 3, "precis": [3, 14, 17, 19], "sai": [3, 13], "decim": [3, 20], "digit": [3, 19, 20, 21, 27], "ad": [3, 9, 19, 21, 27], "tini": [3, 19, 21, 27], "bit": [3, 14, 17, 19, 21, 27], "gaussian": [3, 19, 20, 21, 27], "uniqu": [3, 11, 18, 22, 25, 26], "locat": [3, 7], "therefor": [3, 6, 8, 14, 27], "datatyp": 3, "describ": [3, 12], "csr_matrix": 3, "ascii": 3, "string": [3, 8, 11], "bonferroni_index": [4, 16], "is_sort": 4, "bonferroni": [4, 8, 16], "alreadi": 4, "devergottini_index": [4, 9, 16], "de": [4, 8, 16, 25], "vergottini": [4, 8, 16], "gini_index": [4, 14, 16], "x_1": [4, 5, 16], "dot": [4, 5, 16, 24], "x_n": [4, 16], "frac": [4, 5, 16], "right": [4, 16, 24], "x_": [4, 16], "x_i": [4, 5, 16], "elementi": [4, 16], "di": [4, 16], "statistica": [4, 16], "general": [4, 16], "libreria": [4, 16], "seber": [4, 16], "firenz": [4, 16], "1930": [4, 16, 17], "perfect": [4, 16, 18, 20, 21], "poor": [4, 16], "rich": [4, 16, 20], "91": [4, 21, 27], "robinhood": 4, "83": [4, 21], "77": [4, 21, 27], "x_j": [4, 5, 16], "2i": [4, 16], "sampl": [4, 11, 16, 20, 23, 24], "perceiv": [4, 16], "dispers": [4, 16], "constant": [4, 16], "equiti": [4, 16], "pigou": [4, 16], "dalton": [4, 16], "principl": [4, 16, 28], "schur": [4, 16], "convex": [4, 6, 16, 18], "geq": [4, 16], "econom": [4, 16, 18, 23], "variabilita": [4, 16], "mutabilita": [4, 16], "tipografia": [4, 16], "paolo": [4, 16], "cuppini": [4, 16], "bologna": [4, 16], "1912": [4, 16], "85": [4, 16, 21, 28], "75": [4, 9, 16, 19, 20, 21, 27, 28], "disjointset": 5, "union": [5, 8], "find": [5, 7, 8, 22], "py_ssize_t": 5, "path": [5, 8], "compress": [5, 25], "naiv": [5, 13], "neither": 5, "rank": [5, 20, 21], "nor": [5, 8], "en": 5, "wikipedia": 5, "wiki": 5, "set_data_structur": 5, "design": [5, 28], "current": 5, "assumpt": 5, "parent": 5, "get_k": 5, "get_n": 5, "to_list": 5, "get": [5, 11, 18, 20, 22, 25], "list": [5, 14, 18, 19, 23, 24, 26, 27], "recurs": 5, "to_list_norm": 5, "membership": 5, "slow": [5, 17, 27], "you": [5, 6, 14, 17, 26, 28], "realli": 5, "contain": 5, "first": [5, 6, 8, 14, 18, 22, 24, 25, 27], "second": [5, 25, 27], "whichev": 5, "smaller": [5, 20, 23], "px": 5, "py": [5, 26], "member": [5, 8, 23, 25], "thrown": 5, "ginidisjointset": 5, "augment": [5, 8], "over": [5, 13, 20], "allow": [5, 8, 20, 22, 26, 27], "x_k": 5, "pp": [5, 12, 16], "get_count": 5, "nondecreasingli": [5, 17], "get_gini": 5, "updat": [5, 9, 24], "get_smallest_count": 5, "pessimist": 5, "recomput": [5, 27], "variou": [6, 8, 20], "plot_scatt": [6, 9, 18, 22], "titl": [6, 9, 18, 22, 24, 25], "xlabel": [6, 9], "ylabel": [6, 9], "xlim": [6, 9, 24], "ylim": [6, 9, 24], "kwarg": 6, "draw": 6, "scatter": [6, 18, 22, 24], "style": 6, "matplotlib": [6, 18, 22, 24], "pyplot": [6, 18, 22, 24], "etc": [6, 8, 23], "collect": 6, "further": [6, 8, 14, 17, 27], "unlik": 6, "fix": [6, 9], "drawn": 6, "particular": [6, 9, 18, 19], "black": 6, "red": [6, 25], "green": 6, "blue": [6, 25], "inspir": 6, "distinct": 6, "100": [6, 7, 20, 27], "50": [6, 12, 19, 20, 21, 22, 27], "random": [6, 7, 24], "randn": 6, "repeat": 6, "plt": [6, 18, 22, 24], "show": [6, 18, 22, 24, 25], "png": 6, "hire": 6, "here": [6, 16, 18, 19, 20, 21, 22, 25, 26, 27], "ncol": 6, "len": [6, 18, 22, 24, 26], "col": [6, 14], "nmrk": 6, "mrk": 6, "mrk_recycl": 6, "tile": 6, "ceil": 6, "rang": [6, 18, 19, 22], "text": [6, 24], "horizontalalign": [6, 24], "center": 6, "marker": [6, 22], "color": [6, 23, 24], "markers": 6, "9": [6, 12, 19, 20, 21, 23, 24, 25, 27, 28], "off": [6, 13], "plot_seg": 6, "line": [6, 8, 18, 21], "segment": 6, "pretti": 6, "hull": 6, "import": [6, 8, 18, 22, 24, 25, 26, 27], "convexhul": 6, "mst_from_dist": 6, "necessarili": [7, 19], "argkmin": 7, "posit": 7, "argmin": 7, "argsort": 7, "nk": 7, "insert": 7, "scheme": 7, "practic": [7, 18], "randomli": 7, "almost": [7, 25, 27], "ascend": 7, "100000000": 7, "060": 7, "388": 7, "descend": 7, "168": 7, "329": 7, "073": 7, "673": 7, "403": 7, "505": 7, "414": 7, "072": 7, "447": [7, 19], "061": 7, "390": 7, "007": 7, "639": 7, "075": 7, "299": 7, "2nd": 7, "cummax": 7, "cumul": 7, "maximum": 7, "meaning": [8, 19, 24], "quickli": [8, 27], "larg": [8, 19, 28], "gag21": [8, 18, 28], "gbc16": [8, 18, 20, 22, 26, 28], "behind": 8, "beautifulli": 8, "simpl": [8, 25], "individu": 8, "sole": [8, 12], "own": 8, "Then": [8, 21, 24, 25], "keep": [8, 22], "closest": [8, 18], "anoth": [8, 18], "birch": [8, 20], "complet": [8, 9, 17, 19, 20, 21, 24, 27], "kind": 8, "Of": [8, 24, 27], "cours": [8, 18, 22, 24, 27], "ever": 8, "univers": 8, "everi": [8, 21], "thank": [8, 9, 27, 28], "minim": 8, "million": [8, 18, 19], "minut": [8, 19, 27], "capabl": 8, "extrem": [8, 27, 28], "nbmn19": [8, 27, 28], "cms13": [8, 18, 22, 28], "doesn": 8, "difficult": 8, "via": [8, 18], "pypi": [8, 9, 18], "pip3": [8, 18], "command": [8, 18], "through": 8, "favourit": 8, "manag": 8, "familiar": 8, "scikit": [8, 18, 20, 24, 27, 28], "13": [8, 18, 20, 21, 28], "look": [8, 22], "feel": [8, 22], "fit_predict": [8, 18, 22, 25, 26], "about": [8, 18, 27], "check": [8, 18, 23], "marek": [8, 11, 12, 13, 14, 15, 16, 17, 18], "recent": 8, "access": [8, 9, 13, 18], "free": [8, 18], "textbook": [8, 18], "minimalist": [8, 18, 28], "wrangl": [8, 18, 28], "gag22b": [8, 18, 28], "download": 8, "cran": [8, 9, 23], "interfac": [8, 18], "compat": [8, 14, 18, 23, 27], "stat": [8, 23], "hclust": [8, 14, 23], "gclust": [8, 10, 17, 23], "cutre": [8, 14, 23], "simpli": 8, "reimplement": [8, 14], "geniefi": 8, "retak": 8, "experiment": [8, 9, 12, 28], "preview": [8, 23, 26], "ic": [8, 28], "gic": [8, 9], "cen18": [8, 28], "minimis": 8, "criterion": 8, "mnl12": [8, 20, 28], "gag22a": [8, 28], "rf16": [8, 21, 28], "gbc21": [8, 28], "extens": 8, "gnu": [8, 27], "agpl": 8, "v3": 8, "licens": 8, "header": 8, "adapt": [8, 28], "rel": [8, 11], "easili": [8, 18, 22, 27], "valuabl": 8, "welcom": 8, "julia": 8, "matlab": 8, "author": [8, 9], "maintain": 8, "contributor": [8, 11, 12, 13, 14, 15, 16, 17], "maciej": [8, 9], "anna": [8, 9], "cvi": [8, 9], "peter": 8, "larsen": 8, "shortest": [8, 17], "rectangular": 8, "basic": [8, 23], "break": 8, "read": [8, 21, 23, 25], "toi": [8, 25], "how": [8, 18, 22, 23, 25], "comparis": 8, "movi": 8, "recommend": [8, 18, 19, 20, 27], "dna": 8, "python": [9, 18, 23, 25, 27, 28], "matric": 9, "fewer": 9, "Such": 9, "nonsymmetr": 9, "transpos": 9, "thereof": 9, "build": 9, "ssize_t": 9, "portabl": 9, "mention": [9, 22, 26], "modul": [9, 28], "backward": 9, "incompat": 9, "primit": 9, "partial": 9, "paper": [9, 13, 28], "softwarex": [9, 11, 12, 13, 14, 15, 16, 17, 28], "100722": [9, 11, 12, 13, 14, 15, 16, 17, 28], "softx": [9, 11, 12, 13, 14, 15, 16, 17, 28], "palett": [9, 23], "rcppmlpack": 9, "72": [9, 21, 27], "mere": 9, "upon": 9, "impli": 9, "directli": [9, 23], "remov": [9, 19, 21, 22, 27], "emstreer": 9, "tinytest": 9, "unit": [9, 23], "test": [9, 14, 20], "testthat": 9, "bugfix": 9, "error": 9, "solari": 9, "add": 9, "coverag": 9, "ci": 9, "minor": 9, "inconsist": 9, "autom": 9, "bdist": 9, "chain": 9, "meet": 9, "polici": 9, "broken": 9, "script": [9, 24], "openmp": 9, "been": [9, 21, 27], "rewritten": 9, "jarnik": [9, 17], "fly": [9, 17], "propos": 9, "her": 9, "phd": [9, 28], "thesi": [9, 28], "produc": [9, 25], "initi": 9, "releas": [9, 23, 26], "emst_mlpack": [10, 14, 17], "extra": [10, 25], "wcss": 11, "25l": 11, "better": [11, 19, 20, 23], "fuzzi": [11, 28], "compact": 11, "1973": [11, 25, 28], "32": [11, 14, 17, 19, 21, 27, 28], "57": [11, 17, 21, 27], "01969727308546046": 11, "githubusercont": 11, "gagolew": [11, 14, 18, 23, 26, 28], "bibliographi": 11, "2021cvi": 11, "offici": [11, 12, 13, 14, 15, 16, 17], "onlin": [11, 12, 13, 14, 15, 16, 17], "genieclust": [11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28], "15": [11, 12, 13, 14, 15, 16, 17, 18, 21, 22, 24, 27, 28], "iri": [11, 12, 14, 17, 21], "jitter": 11, "486": 11, "6681": 11, "nrow": 11, "replac": [11, 22], "bad": 11, "836713": 11, "null": 12, "wish": 12, "ami_": 12, "nmi_": 12, "et": [12, 14, 17], "al": [12, 14, 17], "leq": 12, "reorder": 12, "built": 12, "standard": 12, "esp": 12, "meila": 12, "heckerman": 12, "model": [12, 28], "42": [12, 21, 27], "2001": 12, "1023": 12, "1007648401407": 12, "steinlei": 12, "psycholog": 12, "2004": 12, "386": 12, "396": 12, "1037": 12, "1082": 12, "989x": 12, "y_true": 12, "y_pred": [12, 14, 23, 24], "kmean": [12, 18, 27], "84": [12, 21, 27], "7568238": 12, "7470968": 12, "7302383": 12, "8797315": 12, "7304411": 12, "8208081": 12, "8255911": 12, "7581757": 12, "7551192": 12, "48": [12, 21, 27, 28], "14": [12, 21, 24, 27], "36": [12, 17, 21, 27], "dual": 13, "boruvka": 13, "higher": [13, 27], "leaf_siz": 13, "frame": [13, 14, 17, 23, 25], "trade": 13, "speed": [13, 18], "consumpt": 13, "logic": [13, 14, 17], "quadrat": 13, "s3": [14, 17, 21], "dist": [14, 17, 23], "1l": [14, 17, 23], "detect_nois": 14, "arithmet": [14, 17], "2x": [14, 17], "desir": [14, 20, 23], "select": [14, 17, 24], "most": [14, 24, 27], "want": [14, 26], "differ": [14, 19, 20, 22, 24, 27], "explicitli": [14, 20, 22], "occur": 14, "departur": 14, "height": 14, "rev": 14, "na": 14, "routin": [14, 25, 26, 28], "y_test": 14, "pch": 14, "asp": 14, "la": 14, "8857921": 14, "9049708": 14, "90625": 16, "8333333": 16, "7662338": 16, "6493506": 16, "undirect": 17, "sy": 17, "setenv": 17, "gain": 17, "abil": 17, "suboptim": 17, "file": [17, 25], "vertic": 17, "nn": 17, "jistem": 17, "problemu": 17, "minimalnim": 17, "prace": 17, "moravsk": 17, "prirodovedeck": 17, "spolecnosti": 17, "network": 17, "bell": 17, "syst": 17, "tech": 17, "1957": 17, "1389": 17, "1401": 17, "agglom": [18, 20, 27, 28], "link": 18, "mind": [18, 27], "popular": 18, "go": 18, "far": 18, "beyond": 18, "happen": 18, "join": 18, "ll": [18, 23], "frequent": 18, "term": 18, "interact": [18, 23], "panda": [18, 22, 25], "pd": [18, 22, 25], "load": [18, 22, 25], "jain": [18, 21, 28], "jl05": [18, 28], "expert": [18, 22, 26], "devel": [18, 23, 26], "sphinx": [18, 23, 26], "weav": [18, 23], "2d": [18, 24], "loadtxt": [18, 22, 26, 27], "gz": [18, 22, 26, 27], "ndmin": [18, 22, 27], "them": [18, 22], "ish": 18, "subtract": 18, "labels_tru": [18, 22, 26], "labels0": [18, 22, 26], "intp": [18, 22, 26], "equip": 18, "labels_geni": [18, 22], "document": [18, 21, 23], "discov": [18, 28], "predict": [18, 19, 20, 22, 24], "nice": [18, 24, 27], "pictur": 18, "thousand": 18, "word": 18, "276": 18, "97": [18, 21, 27], "sklearn": [18, 24, 27], "sake": 18, "km": 18, "labels_kmean": 18, "known": [18, 20, 22], "split": 18, "region": 18, "voronoi": 18, "diagram": 18, "shouldn": 18, "surpris": 18, "197": 18, "79": [18, 19, 21, 27], "96": [18, 21, 24, 27, 28], "3241080446115835": 18, "sim": 18, "against": [18, 20, 27], "eksx96": [18, 28], "lin73": [18, 28], "hard": [18, 25], "tune": [18, 22], "mha17": [18, 22, 28], "friendli": 18, "mc": 18, "labels_hdbscan": [18, 22], "subplot": [18, 22, 24], "side": 18, "symbol": 18, "back": [18, 25], "demand": 18, "granular": [18, 22], "unfortun": 18, "cannot": 18, "guess": 18, "At": [18, 21, 27], "glanc": 18, "seem": 18, "lie": 18, "somewher": 18, "16": [18, 19, 21, 27], "strang": 18, "enough": 18, "wherea": 18, "pm": 18, "On": [18, 19, 27], "belong": 18, "sequenc": 18, "nest": 18, "subgroup": 18, "ncl": 18, "linkage_matrix": 18, "column_stack": 18, "show_leaf_count": 18, "no_label": 18, "truncate_mod": 18, "lastp": 18, "orient": 18, "api": [18, 21, 28], "previou": [19, 27], "demonstr": [19, 27], "search": [19, 25, 26, 27], "high": [19, 25, 26, 27], "100d": 19, "laptop": 19, "tl": [19, 24], "dr": [19, 24], "spoiler": 19, "alert": 19, "again": [19, 22], "consid": [19, 20, 23, 25, 27], "suit": [19, 20, 21, 27, 28], "h2mg": [19, 20], "g2mg": [19, 20], "batteri": [19, 20], "altogeth": 19, "fire": 19, "ve": 19, "discrep": 19, "seen": 19, "sipu": [19, 21, 27], "birch2": [19, 21], "01": [19, 20, 21, 24], "02": [19, 21, 24, 27], "35": [19, 21, 27], "44": [19, 21, 27], "43": [19, 21, 25], "worms_64": [19, 21, 27], "03": [19, 21, 27], "06": [19, 21], "08": [19, 21, 27], "34": [19, 21, 27], "wut": [19, 21], "trajectori": [19, 21], "noteworthi": 19, "wors": [19, 27], "although": 19, "recal": [19, 27], "interestingli": [19, 20], "outcom": [19, 20], "across": 19, "chose": 19, "median": [19, 20, 21, 27], "genie_0": [19, 20, 21, 27], "728": 19, "307": 19, "516": 19, "844": 19, "1_approx": 19, "755": 19, "292": 19, "555": 19, "3_approx": [19, 27], "568": 19, "731": 19, "332": 19, "531": 19, "5_approx": 19, "734": 19, "326": 19, "624": 19, "376": 19, "264": [19, 28], "719": [19, 27], "7_approx": 19, "genie_1": 19, "415": 19, "174": 19, "0_approx": 19, "409": 19, "45": [19, 21], "148": 19, "evalu": 20, "aggreg": [20, 21, 23, 28], "limit": [20, 27], "dg19": [20, 28], "fmiz16": [20, 28], "fs18": [20, 28], "gp10": [20, 28], "khk99": [20, 28], "ult05": [20, 28], "alongsid": 20, "studi": [20, 27, 28], "fastclust": [20, 27, 28], "mul13": [20, 27, 28], "maximis": 20, "em": 20, "mixtur": [20, 21], "spectral": 20, "itm": [20, 21, 28], "ha85": [20, 21, 28], "plausibl": 20, "dn09": [20, 28], "appendix": 20, "reason": [20, 23], "restrict": [20, 23], "ourselv": [20, 23], "000": [20, 27], "omit": 20, "popul": 20, "parametr": 20, "boxplot": 20, "empir": [20, 25], "lead": 20, "highest": 20, "former": 20, "grid": 20, "branching_factor": 20, "005": 20, "025": 20, "rbf": 20, "laplacian": 20, "poli": 20, "sigmoid": 20, "gamma": 20, "n_init": [20, 27], "subject": 20, "perhap": 20, "lesser": 20, "lower": 20, "birch_0": [20, 21], "12": [20, 21, 27, 28], "spectral_rbf_5": [20, 21], "70": [20, 27], "105": [20, 27], "600": [20, 27], "overal": [20, 27], "inspect": 20, "quit": 20, "sens": 20, "signific": 20, "present": 21, "fm83": [21, 28], "veb10": [21, 28], "wherev": 21, "38": [21, 27], "92": [21, 27], "54": [21, 27], "19": 21, "46": [21, 25, 27], "47": [21, 27], "78": [21, 28], "37": [21, 23, 27], "82": [21, 28], "98": [21, 24, 27], "31": 21, "88": [21, 27], "59": [21, 27], "76": [21, 27], "56": 21, "68": [21, 27, 28], "69": [21, 27], "99": [21, 24], "51": [21, 27], "89": [21, 25, 27], "33": [21, 27], "fcp": 21, "atom": 21, "chainlink": 21, "09": 21, "engytim": 21, "04": [21, 27], "hepta": 21, "lsun": 21, "target": 21, "tetra": 21, "twodiamond": 21, "wingnut": 21, "86": [21, 27], "grave": [21, 28], "81": [21, 27], "fuzzyx": 21, "93": [21, 27], "parabol": 21, "66": [21, 27], "62": [21, 27], "ring": 21, "ring_noisi": 21, "ring_outli": 21, "zigzag": 21, "zigzag_noisi": 21, "52": [21, 27], "zigzag_outli": 21, "chameleon_t4_8k": 21, "55": [21, 27], "61": 21, "chameleon_t5_8k": 21, "chameleon_t7_10k": 21, "chameleon_t8_8k": 21, "iris5": 21, "17": [21, 27, 28], "a1": 21, "94": 21, "a2": 21, "a3": 21, "compound": 21, "d31": 21, "flame": 21, "22": [21, 27], "pathbas": 21, "r15": 21, "s1": 21, "s2": 21, "67": [21, 27], "s4": 21, "spiral": 21, "unbal": 21, "uci": [21, 28], "ecoli": 21, "glass": 21, "24": [21, 27], "ionospher": 21, "sonar": 21, "statlog": 21, "nan": 21, "wdbc": 21, "wine": 21, "yeast": 21, "circl": 21, "cross": 21, "07": [21, 27], "isol": 21, "labirynth": 21, "mk1": 21, "mk2": 21, "mk3": 21, "mk4": 21, "olymp": 21, "smile": 21, "stripe": 21, "trapped_lov": 21, "twosplash": 21, "window": 21, "x1": 21, "x2": 21, "x3": 21, "z1": 21, "z2": 21, "z3": 21, "58": [21, 27], "wise": 21, "heat": 21, "map": [21, 25, 28], "mnist": [21, 27], "fashion": [21, 27], "birch1": 21, "worms_2": [21, 27], "project": [22, 25, 28], "site": 22, "reveal": 22, "goal": 22, "light": 22, "grei": 22, "alpha": 22, "d_m": 22, "parameteris": 22, "eagerli": 22, "plai": 22, "natur": 22, "temporarili": 22, "did": 22, "step": 22, "identif": 22, "g1": 22, "labels_nois": 22, "non_nois": 22, "g2": 22, "old": [22, 25], "excel": 22, "still": [22, 27], "hood": 22, "ask": 22, "switch": 22, "finer": 22, "nc": 22, "min_sampl": 22, "closer": 22, "mcss": 22, "mss": 22, "neat": 22, "latest": 23, "repositori": [23, 28], "sustain": 23, "societi": 23, "human": 23, "environment": 23, "wellb": 23, "countri": 23, "seven": 23, "categori": [23, 24], "ssi": 23, "csv": [23, 25], "ssi_2016_categori": 23, "comment": 23, "char": 23, "everyth": 23, "1st": 23, "dimnam": 23, "head": [23, 25], "basicne": 23, "personaldevelopmentandhealth": 23, "wellbalancedsocieti": 23, "naturalresourc": 23, "climateandenergi": 23, "transit": 23, "economi": 23, "albania": 23, "605769": 23, "959609": 23, "992649": 23, "634251": 23, "621681": 23, "102542": 23, "056494": 23, "algeria": 23, "021185": 23, "336496": 23, "203906": 23, "277173": 23, "662674": 23, "074134": 23, "154272": 23, "angola": 23, "972848": 23, "692808": 23, "140138": 23, "759396": 23, "212197": 23, "898812": 23, "753476": 23, "argentina": 23, "831955": 23, "350592": 23, "895167": 23, "453451": 23, "300326": 23, "389867": 23, "340636": 23, "armenia": 23, "446943": 23, "420523": 23, "289224": 23, "436303": 23, "854317": 23, "434233": 23, "829620": 23, "australia": 23, "000000": 23, "590927": 23, "105539": 23, "130701": 23, "627805": 23, "539498": 23, "593052": 23, "workhors": 23, "yet": 23, "effici": [23, 27], "feed": 23, "glust": 23, "154": 23, "extract": [23, 25, 27], "bolivia": 23, "ghana": 23, "russia": 23, "ethiopia": 23, "zimbabw": 23, "yemen": 23, "mauritania": 23, "mauritiu": 23, "state": 23, "mexico": 23, "thailand": 23, "namibia": 23, "korea": 23, "north": 23, "chile": 23, "austria": 23, "ukrain": 23, "lebanon": 23, "libya": 23, "vietnam": 23, "nicaragua": 23, "romania": 23, "lao": 23, "cote": 23, "ivoir": 23, "panama": 23, "tunisia": 23, "alloc": 23, "depict": 23, "rworldmap": 23, "mapdata": 23, "joincountrydata2map": 23, "joincod": 23, "namejoincolumn": 23, "mapcountrydata": 23, "namecolumntoplot": 23, "catmethod": 23, "categor": 23, "missingcountrycol": 23, "white": 23, "colourpalett": 23, "r4": 23, "maptitl": 23, "067901": 23, "268879": 23, "817850": 23, "508130": 23, "931156": 23, "299537": 23, "886885": 23, "868176": 23, "827154": 23, "663252": 23, "004013": 23, "374348": 23, "624147": 23, "081801": 23, "594718": 23, "074894": 23, "630009": 23, "340152": 23, "512709": 23, "541081": 23, "274155": 23, "readabl": 23, "oecd": 23, "belgium": 23, "canada": 23, "colombia": 23, "czech": 23, "republ": 23, "denmark": 23, "estonia": 23, "finland": 23, "franc": 23, "germani": 23, "greec": 23, "hungari": 23, "iceland": 23, "ireland": 23, "israel": 23, "itali": 23, "japan": 23, "south": 23, "latvia": 23, "lithuania": 23, "luxembourg": 23, "netherland": 23, "zealand": 23, "norwai": 23, "poland": 23, "portug": 23, "slovak": 23, "slovenia": 23, "spain": 23, "sweden": 23, "switzerland": 23, "turkei": 23, "kingdom": 23, "x_oecd": 23, "h_oecd": 23, "final": 23, "interest": 23, "specif": [23, 24, 26], "slightli": [23, 27], "don": [23, 25], "forget": 23, "regard": 23, "There": 24, "websit": [24, 25], "characterist": 24, "re": [24, 27], "illustr": [24, 25], "game": [24, 25], "figur": 24, "bottom": 24, "standardscal": 24, "itertool": 24, "cycl": 24, "islic": 24, "seed": 24, "1234": 24, "1500": 24, "10000": [24, 27], "noisy_circl": 24, "make_circl": 24, "noisy_moon": 24, "make_moon": 24, "make_blob": 24, "random_st": 24, "no_structur": 24, "anisotrop": 24, "170": 24, "x_aniso": 24, "aniso": 24, "vari": 24, "cluster_std": 24, "figsiz": 24, "subplots_adjust": 24, "001": 24, "wspace": 24, "hspace": 24, "plot_num": 24, "default_bas": 24, "n_neighbor": 24, "i_dataset": 24, "algo_param": 24, "enumer": 24, "param": 24, "copi": 24, "easier": 24, "fit_transform": 24, "agglomerativeclust": 24, "clustering_algorithm": 24, "t0": [24, 27], "catch": 24, "relat": 24, "kneighbors_graph": 24, "catch_warn": 24, "filterwarn": 24, "avoid": 24, "stop": 24, "earli": 24, "userwarn": 24, "t1": 24, "hasattr": 24, "astyp": 24, "els": 24, "377eb8": 24, "ff7f00": 24, "4daf4a": 24, "f781bf": 24, "a65628": 24, "984ea3": 24, "999999": 24, "e41a1c": 24, "dede00": 24, "xtick": 24, "ytick": 24, "2f": 24, "lstrip": 24, "gca": 24, "transax": 24, "box": 24, "fastest": [24, 27], "ideal": 24, "next": 24, "challeng": 24, "handl": 25, "exercis": 25, "movielen": 25, "consecut": [25, 27], "read_csv": 25, "ml": [25, 28], "movieid": 25, "userid": 25, "old_movieid_map": 25, "searchsort": 25, "timestamp": 25, "964982703": 25, "964981247": 25, "964982224": 25, "964983815": 25, "964982931": 25, "metadata": 25, "loc": 25, "isin": 25, "iloc": 25, "stori": 25, "jumanji": 25, "grumpier": 25, "men": 25, "wait": 25, "exhal": 25, "father": 25, "bride": 25, "ii": 25, "convers": 25, "csr": 25, "dok_matrix": 25, "tocsr": 25, "repr": 25, "9724x610": 25, "100836": 25, "todens": 25, "200": 25, "film": 25, "which_clust": 25, "monti": 25, "life": 25, "1983": [25, 28], "sort_valu": 25, "2097": 25, "airplan": 25, "1980": 25, "2907": 25, "famou": 25, "2000": 25, "1914": 25, "analyz": 25, "1999": [25, 28], "969": 25, "futur": 25, "1486": 25, "1989": 25, "1487": 25, "iii": 25, "1990": 25, "2259": 25, "Being": 25, "john": 25, "malkovich": 25, "2916": 25, "921": 25, "brother": 25, "bottl": 25, "rocket": 25, "1996": [25, 28], "2084": 25, "bowfing": 25, "2190": 25, "boi": 25, "cry": 25, "2888": 25, "cell": 25, "832": 25, "door": 25, "1991": 25, "955": 25, "duck": 25, "soup": 25, "1933": 25, "836": 25, "terrestri": 25, "1982": 25, "1960": 25, "elect": 25, "2036": 25, "ey": 25, "wide": 25, "shut": 25, "819": 25, "fish": 25, "wanda": 25, "1988": 25, "1232": 25, "full": 25, "1997": 25, "964": 25, "groundhog": 25, "dai": 25, "1993": 25, "2605": 25, "fidel": 25, "1211": 25, "hunt": 25, "octob": 25, "2382": 25, "magnolia": 25, "863": 25, "holi": 25, "grail": 25, "1975": 25, "2094": 25, "And": 25, "someth": 25, "completel": 25, "820": 25, "brian": 25, "4581": 25, "2892": 25, "nake": 25, "gun": 25, "smell": 25, "fear": 25, "2891": 25, "polic": 25, "squad": 25, "3010": 25, "art": [25, 28], "thou": 25, "1394": 25, "sight": 25, "2443": 25, "patriot": 25, "1992": 25, "850": 25, "peopl": 25, "larri": 25, "flynt": 25, "899": 25, "princess": 25, "2020": [25, 28], "lola": 25, "rennt": 25, "1796": 25, "rushmor": 25, "star": 25, "war": 25, "episod": 25, "phantom": 25, "menac": 25, "iv": 25, "hope": 25, "1977": 25, "898": 25, "strike": 25, "911": [25, 27], "vi": 25, "jedi": 25, "934": 25, "sting": 25, "2030": 25, "summer": 25, "sam": 25, "987": 25, "spinal": 25, "tap": 25, "1984": 25, "2174": 25, "three": 25, "king": 25, "839": 25, "1986": 25, "3016": 25, "traffic": 25, "1113": 25, "guffman": 25, "977": 25, "young": 25, "frankenstein": 25, "abridg": 25, "databas": [25, 28], "889x283": 25, "228": 25, "753": 25, "444": 25, "zero": 25, "144": 25, "500": 25, "13327": 25, "blackadd": 25, "forth": 25, "13328": 25, "christma": 25, "carol": 25, "3341": 25, "creatur": 25, "comfort": 25, "1197": 25, "grand": 25, "wallac": 25, "gromit": 25, "2778": 25, "night": 25, "1964": 25, "2861": 25, "help": 25, "2963": 25, "won": 25, "1967": 25, "6006": 25, "live": 25, "hollywood": 25, "bowl": 25, "2703": 25, "1058": 25, "6698": 25, "27284": 25, "oliv": 25, "twist": 25, "2216": 25, "1968": 25, "4716": 25, "quadrophenia": 25, "6027": 25, "secret": 25, "policeman": 25, "27448": 25, "basket": 25, "2792": 25, "tommi": 25, "10475": 25, "curs": [25, 27], "rabb": 25, "732": 25, "close": 25, "shave": 25, "708": 25, "aardman": 25, "animatio": 25, "1125": 25, "wrong": 25, "trouser": 25, "13239": 25, "loaf": 25, "2772": 25, "yellow": 25, "submarin": 25, "1250": 25, "charact": 26, "levenshtein": 26, "edit": 26, "rmd": 26, "actg1": 26, "tolist": 26, "tmp": 26, "ipykernel_15571": 26, "1616393685": 26, "deprecationwarn": 26, "deprec": 26, "alia": 26, "builtin": 26, "silenc": 26, "modifi": 26, "behavior": 26, "safe": [26, 27], "scalar": 26, "str_": 26, "guidanc": 26, "devdoc": 26, "html": [26, 28], "tataacaaccctgattacatcaagctacgctccggtgcgttgcctcggacgagtgctaatccctccccactgactgtattcatcttgacaata": 26, "atgtctccaaagcgtgaccttctagacccgagacgacatatggaggcttggagccgtacctgtgtgaggaaactgtagtacccaaagctattca": 26, "gcaattgaagtccagatctaggtatcgtccaagcatattgcctttaagaaatatatttgaccctgtctcttcgtggaggtacacgtcacggaatcgtaagatttccttgg": 26, "gacaattatcgcggctttcgccatgcagagtctcgtacaatttgtttcacgcccaatattttccgtgcttcgcgagctaggcagccagggcatttttgga": 26, "ttagagcgcttaaccccacaggaaccgagttcccctcatgtggcaaggttctcccgcctcaggtatcacagaaacaaggtatgtagccctaggctacgagc": 26, "domain": 26, "convert": 26, "labels_pr": 26, "9352814722212013": 26, "crucial": 27, "question": 27, "resourc": 27, "restart": 27, "ols95": [27, 28], "cel": [27, 28], "mrg10": [27, 28], "automat": 27, "pc": 27, "linux": 27, "40": 27, "ubuntu": 27, "smp": 27, "x86_64": 27, "kernel": [27, 28], "intel": 27, "tm": 27, "i7": 27, "9750h": 27, "cpu": 27, "60ghz": 27, "12m": 27, "cach": 27, "242": 27, "084": 27, "kb": 27, "irrespect": 27, "1000": 27, "70000": 27, "412": 27, "fastcluster_centroid": 27, "4170": 27, "fastcluster_median": 27, "3927": 27, "fastcluster_ward": 27, "4114": 27, "sklearn_kmean": 27, "217": [27, 28], "1691": 27, "784": 27, "445": 27, "4486": 27, "4384": 27, "4757": 27, "225": 27, "1745": 27, "105600": 27, "60": 27, "111": 27, "105000": 27, "4945": 27, "778": 27, "357": 27, "degrad": 27, "choic": 27, "kmkm17": [27, 28], "importantli": 27, "slower": 27, "synthet": 27, "50000": 27, "100000": 27, "500000": 27, "1000000": 27, "158": 27, "202": 27, "113": 27, "266": 27, "3_mlpack": 27, "794": 27, "2014": 27, "3_nomlpack": 27, "267": 27, "1657": 27, "421": 27, "2997": 27, "4388": 27, "1627": 27, "7708": 27, "2175": 27, "11346": 27, "132": 27, "4408": 27, "16021": 27, "clearli": 27, "visibl": 27, "done": 27, "physic": 27, "evidenc": 27, "1m": 27, "pool": 27, "elaps": 27, "3f": 27, "set_param": 27, "028": 27, "public": 28, "pleas": 28, "buitinck": 28, "xperienc": 28, "ecml": 28, "pkdd": 28, "workshop": 28, "languag": 28, "108": 28, "122": 28, "polish": 28, "academi": 28, "dasgupta": 28, "ng": 28, "nip": 28, "toward": 28, "2009": 28, "url": 28, "clusteringtheori": 28, "dua": 28, "graff": 28, "archiv": 28, "edu": 28, "ester": 28, "kriegel": 28, "xu": 28, "kdd": 28, "page": 28, "226": 28, "231": 28, "american": 28, "associ": 28, "383": 28, "553": 28, "569": 28, "fr\u00e4nti": 28, "mariescu": 28, "istodor": 28, "zhong": 28, "xnn": 28, "10029": 28, "207": 28, "319": 28, "49055": 28, "7_19": 28, "sieranoja": 28, "six": 28, "4743": 28, "4759": 28, "s10489": 28, "018": 28, "1238": 28, "ast": 28, "zenodo": 28, "melbourn": 28, "isbn": 28, "6455719": 28, "datawranglingpi": 28, "5281": 28, "6451068": 28, "3815066": 28, "pedrycz": 28, "161": 28, "522": 28, "543": 28, "fss": 28, "021": 28, "bf01908075": 28, "law": 28, "dilemma": 28, "3776": 28, "2005": 28, "karypi": 28, "han": 28, "kumar": 28, "chameleon": 28, "ierarch": 28, "dynam": 28, "781637": 28, "kobren": 28, "monath": 28, "krishnamurthi": 28, "mccallum": 28, "23rd": 28, "255": 28, "2017": 28, "1145": 28, "3097983": 28, "3098079": 28, "ling": 28, "theori": 28, "341": 28, "159": 28, "164": 28, "uclidean": 28, "lgorithm": 28, "16th": 28, "612": 28, "1835804": 28, "1835882": 28, "mcinn": 28, "heali": 28, "astel": 28, "205": 28, "00205": 28, "m\u00fcller": 28, "nowozin": 28, "lampert": 28, "german": 28, "confer": 28, "recognit": 28, "2012": 28, "amuel": 28, "m\u00fcllner": 28, "18637": 28, "jss": 28, "v053": 28, "i09": 28, "pedregosa": 28, "achin": 28, "ython": 28, "2825": 28, "2830": 28, "2011": 28, "jmlr": 28, "v12": 28, "pedregosa11a": 28, "engin": 28, "ultsch": 28, "som": 28, "u": 28, "organ": 28, "ariant": 28, "v11": 28, "vinh10a": 28, "www": 28, "danifold": 28, "net": 28, "contrib": 28, "python_bind": 28}, "objects": {"genieclust": [[3, 0, 1, "", "Genie"], [1, 2, 0, "-", "cluster_validity"], [2, 2, 0, "-", "compare_partitions"], [4, 2, 0, "-", "inequity"], [5, 2, 0, "-", "internal"], [6, 2, 0, "-", "plots"], [7, 2, 0, "-", "tools"]], "genieclust.Genie": [[3, 1, 1, "", "fit"]], "genieclust.cluster_validity": [[1, 3, 1, "", "calinski_harabasz_index"], [1, 3, 1, "", "dunnowa_index"], [1, 3, 1, "", "generalised_dunn_index"], [1, 3, 1, "", "negated_ball_hall_index"], [1, 3, 1, "", "negated_davies_bouldin_index"], [1, 3, 1, "", "negated_wcss_index"], [1, 3, 1, "", "silhouette_index"], [1, 3, 1, "", "silhouette_w_index"], [1, 3, 1, "", "wcnn_index"]], "genieclust.compare_partitions": [[2, 3, 1, "", "adjusted_asymmetric_accuracy"], [2, 3, 1, "", "adjusted_fm_score"], [2, 3, 1, "", "adjusted_mi_score"], [2, 3, 1, "", "adjusted_rand_score"], [2, 3, 1, "", "compare_partitions"], [2, 3, 1, "", "compare_partitions2"], [2, 3, 1, "", "confusion_matrix"], [2, 3, 1, "", "fm_score"], [2, 3, 1, "", "mi_score"], [2, 3, 1, "", "normalize_confusion_matrix"], [2, 3, 1, "", "normalized_accuracy"], [2, 3, 1, "", "normalized_confusion_matrix"], [2, 3, 1, "", "normalized_mi_score"], [2, 3, 1, "", "normalizing_permutation"], [2, 3, 1, "", "pair_sets_index"], [2, 3, 1, "", "rand_score"]], "genieclust.inequity": [[4, 3, 1, "", "bonferroni_index"], [4, 3, 1, "", "devergottini_index"], [4, 3, 1, "", "gini_index"]], "genieclust.internal": [[5, 0, 1, "", "DisjointSets"], [5, 0, 1, "", "GiniDisjointSets"]], "genieclust.internal.DisjointSets": [[5, 1, 1, "", "find"], [5, 1, 1, "", "get_k"], [5, 1, 1, "", "get_n"], [5, 1, 1, "", "to_list"], [5, 1, 1, "", "to_list_normalized"], [5, 1, 1, "", "to_lists"], [5, 1, 1, "", "union"]], "genieclust.internal.GiniDisjointSets": [[5, 1, 1, "", "find"], [5, 1, 1, "", "get_count"], [5, 1, 1, "", "get_counts"], [5, 1, 1, "", "get_gini"], [5, 1, 1, "", "get_k"], [5, 1, 1, "", "get_n"], [5, 1, 1, "", "get_smallest_count"], [5, 1, 1, "", "to_list"], [5, 1, 1, "", "to_list_normalized"], [5, 1, 1, "", "to_lists"], [5, 1, 1, "", "union"]], "genieclust.plots": [[6, 3, 1, "", "plot_scatter"], [6, 3, 1, "", "plot_segments"]], "genieclust.tools": [[7, 3, 1, "", "argkmin"], [7, 3, 1, "", "cummax"], [7, 3, 1, "", "cummin"]]}, "objtypes": {"0": "py:class", "1": "py:method", "2": "py:module", "3": "py:function"}, "objnames": {"0": ["py", "class", "Python class"], "1": ["py", "method", "Python method"], "2": ["py", "module", "Python module"], "3": ["py", "function", "Python function"]}, "titleterms": {"python": [0, 8], "packag": [0, 8, 10, 15], "genieclust": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15], "refer": [0, 10, 11, 12, 13, 14, 16, 17, 28], "modul": 0, "class": 0, "cluster_valid": [1, 11], "compare_partit": [2, 12], "geni": [3, 14, 15], "inequ": [4, 16], "intern": [5, 11], "plot": 6, "tool": 7, "fast": [8, 27], "robust": 8, "hierarch": [8, 14, 15], "cluster": [8, 11, 12, 14, 15, 22], "nois": [8, 22], "point": [8, 22], "detect": [8, 22], "version": 8, "r": [8, 10, 23], "featur": 8, "contribut": 8, "exampl": [8, 11, 12, 14, 16, 17, 23, 25, 26], "tutori": 8, "api": 8, "document": 8, "see": [8, 11, 12, 13, 14, 15, 16, 17, 28], "also": [8, 11, 12, 13, 14, 15, 16, 17, 28], "appendix": 8, "what": 9, "i": [9, 20, 27], "new": 9, "1": 9, "2": 9, "2022": 9, "09": 9, "17": 9, "15": 9, "0": 9, "05": 9, "08": 9, "2021": 9, "04": 9, "22": 9, "9": 9, "8": 9, "01": 9, "4": 9, "2020": 9, "07": 9, "31": 9, "3": 9, "25": 9, "18": 9, "1a2": 9, "2018": 9, "23": 9, "valid": [11, 12], "measur": [11, 12, 16], "descript": [11, 12, 13, 14, 15, 16, 17], "usag": [11, 12, 13, 14, 16, 17], "argument": [11, 12, 13, 14, 16, 17], "valu": [11, 12, 13, 14, 16, 17], "author": [11, 12, 13, 14, 15, 16, 17], "": [11, 12, 13, 14, 15, 16, 17], "extern": 12, "pairwis": [12, 17], "partit": 12, "similar": 12, "score": 12, "detail": [12, 14, 16, 17, 21], "emst_mlpack": 13, "euclidean": 13, "minimum": [13, 17], "span": [13, 17], "tree": [13, 17], "gclust": 14, "algorithm": [14, 15, 24], "The": 15, "extra": 15, "mst": 17, "distanc": 17, "graph": 17, "basic": 18, "break": 18, "ic": 18, "A": [18, 22], "comparison": 18, "k": 18, "mean": 18, "hdbscan": [18, 22], "dendrogram": 18, "further": 18, "read": 18, "benchmark": [19, 20, 21], "approxim": 19, "method": 19, "how": [20, 27, 28], "good": 20, "It": [20, 27], "small": [20, 21], "dataset": [20, 21, 24, 27], "larg": [20, 21, 27], "summari": [20, 21, 27], "result": 21, "ar": 21, "fm": 21, "ami": 21, "nmi": 21, "nacc": 21, "psi": 21, "smooth": 22, "factor": 22, "comparis": 22, "interfac": 23, "compar": 24, "toi": 24, "spars": 25, "data": [25, 26], "movi": 25, "recommend": 25, "string": 26, "group": 26, "dna": 26, "time": 27, "function": 27, "n": 27, "d": 27, "number": 27, "thread": 27, "cite": 28, "bibliographi": 28}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 6, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinxcontrib.bibtex": 9, "sphinx.ext.todo": 2, "sphinx": 56}})
\ No newline at end of file
diff --git a/docs/weave/basics.html b/docs/weave/basics.html
index 269673f5..642faacf 100644
--- a/docs/weave/basics.html
+++ b/docs/weave/basics.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -528,7 +528,7 @@ <h2>Further Reading<a class="headerlink" href="#further-reading" title="Permalin
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/weave/benchmarks_approx.html b/docs/weave/benchmarks_approx.html
index 02b17050..94d99cb9 100644
--- a/docs/weave/benchmarks_approx.html
+++ b/docs/weave/benchmarks_approx.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -551,7 +551,7 @@ <h1>Benchmarks — Approximate Method<a class="headerlink" href="#benchmarks-app
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/weave/benchmarks_ar.html b/docs/weave/benchmarks_ar.html
index 2e35adb1..2280188c 100644
--- a/docs/weave/benchmarks_ar.html
+++ b/docs/weave/benchmarks_ar.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -604,7 +604,7 @@ <h2>Summary<a class="headerlink" href="#summary" title="Permalink to this headin
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/weave/benchmarks_details.html b/docs/weave/benchmarks_details.html
index 09da15ec..f23b6f49 100644
--- a/docs/weave/benchmarks_details.html
+++ b/docs/weave/benchmarks_details.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -10875,7 +10875,7 @@ <h3>Summary<a class="headerlink" href="#id12" title="Permalink to this heading">
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/weave/noise.html b/docs/weave/noise.html
index 821ef6fe..373b0d09 100644
--- a/docs/weave/noise.html
+++ b/docs/weave/noise.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -417,7 +417,7 @@ <h2>A Comparision with HDBSCAN*<a class="headerlink" href="#a-comparision-with-h
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/weave/r.html b/docs/weave/r.html
index c210319d..b3bb11cf 100644
--- a/docs/weave/r.html
+++ b/docs/weave/r.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -366,7 +366,7 @@ <h1>R Interface Examples<a class="headerlink" href="#r-interface-examples" title
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/weave/sklearn_toy_example.html b/docs/weave/sklearn_toy_example.html
index a363c030..e3aec786 100644
--- a/docs/weave/sklearn_toy_example.html
+++ b/docs/weave/sklearn_toy_example.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -397,7 +397,7 @@ <h1>Comparing Algorithms on Toy Datasets<a class="headerlink" href="#comparing-a
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/weave/sparse.html b/docs/weave/sparse.html
index f3e0b111..25188bf4 100644
--- a/docs/weave/sparse.html
+++ b/docs/weave/sparse.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -429,7 +429,7 @@ <h1>Example: Sparse Data and Movie Recommendation<a class="headerlink" href="#ex
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/weave/string.html b/docs/weave/string.html
index 15b5809f..a1947b50 100644
--- a/docs/weave/string.html
+++ b/docs/weave/string.html
@@ -78,7 +78,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -316,7 +316,7 @@ <h1>Example: String Data and Grouping of DNA<a class="headerlink" href="#example
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/weave/timings.html b/docs/weave/timings.html
index 5b8ed269..825c66d5 100644
--- a/docs/weave/timings.html
+++ b/docs/weave/timings.html
@@ -80,7 +80,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -745,7 +745,7 @@ <h2>Summary<a class="headerlink" href="#summary" title="Permalink to this headin
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/docs/z_bibliography.html b/docs/z_bibliography.html
index 71ba1f21..a69aaa6b 100644
--- a/docs/z_bibliography.html
+++ b/docs/z_bibliography.html
@@ -77,7 +77,7 @@
           </a>
 
           <div class="version">
-              Python and R Package<br />    v1.1.1
+              Python and R Package<br />    v1.1.2
           </div>
 
 <!--
@@ -386,7 +386,7 @@ <h2>See Also<a class="headerlink" href="#see-also" title="Permalink to this head
     and a customised <a href="https://github.com/rtfd/sphinx_rtd_theme">rtd</a>
     theme.
       <span class="lastupdated">
-        Last updated on 2022-09-15T13:23:22+1000.
+        Last updated on 2022-09-17T17:13:14+1000.
       </span>
 
 
diff --git a/genieclust/__init__.py b/genieclust/__init__.py
index 8dd576f9..0541f0fe 100644
--- a/genieclust/__init__.py
+++ b/genieclust/__init__.py
@@ -21,7 +21,7 @@
 # ############################################################################ #
 
 # version string, e.g., "1.0.0.9001" or "1.1.1"
-__version__ = "1.1.1.9001"
+__version__ = "1.1.2"
 
 
 from . import plots