Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

move models to JSON files #200

Open
wants to merge 2 commits into
base: main
Choose a base branch
from
Open

move models to JSON files #200

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
2 commits
Select commit Hold shift + click to select a range
17ed94a
factored models into json files
jamestwebber Apr 6, 2023
dcb91e7
renamed json dir to 'models'
jamestwebber Apr 6, 2023
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
1 change: 1 addition & 0 deletions MANIFEST.in
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -4,6 +4,7 @@ graft src
include README.rst
include LICENSE.txt
include tox.ini .travis.yml
include src/longbow/models/*.json

prune **/.hypothesis

Expand Down
Empty file added src/longbow/models/__init__.py
View file
Open in desktop
Empty file.
59 changes: 59 additions & 0 deletions src/longbow/models/bulk_10x5p.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,59 @@
{
"cdna": {
"description": "bulk 10x 5' kit",
"version": "3.0.0",
"structure": [
"5p_Adapter",
"UMI",
"SLS",
"cDNA",
"Poly_A",
"sample_index",
"3p_Adapter"
],
"adapters": {
"5p_Adapter": "TCTACACGACGCTCTTCCGATCT",
"UMI": {
"FixedLengthRandomBases": 10
},
"SLS": "TTTCTTATATGGG",
"cDNA": "random",
"Poly_A": {
"HomopolymerRepeat": [
"A",
30
]
},
"sample_index": {
"FixedLengthRandomBases": 10
},
"3p_Adapter": "CTCTGCGTTGATACCACTGCTT"
},
"named_random_segments": [
"UMI",
"cDNA",
"sample_index"
],
"coding_region": "cDNA",
"annotation_segments": {
"UMI": [
[
"ZU",
"XU"
],
[
"XM",
"XU"
]
],
"sample_index": [
[
"id",
"ip"
]
]
},
"deprecated": false,
"name": "bulk_10x5p"
}
}
42 changes: 42 additions & 0 deletions src/longbow/models/bulk_teloprimeV2.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,42 @@
{
"cdna": {
"description": "Lexogen TeloPrime V2 kit",
"version": "3.0.0",
"structure": [
"TPV2_adapter",
"cDNA",
"Poly_A",
"idx",
"rev_bind"
],
"adapters": {
"TPV2_adapter": "CTACACGACGCTCTTCCGATCTTGGATTGATATGTAATACGACTCACTATAG",
"cDNA": "random",
"Poly_A": {
"HomopolymerRepeat": [
"A",
30
]
},
"idx": {
"FixedLengthRandomBases": 10
},
"rev_bind": "CTCTGCGTTGATACCACTGCTT"
},
"named_random_segments": [
"idx",
"cDNA"
],
"coding_region": "cDNA",
"annotation_segments": {
"idx": [
[
"BC",
"XB"
]
]
},
"deprecated": false,
"name": "bulk_teloprimeV2"
}
}
16 changes: 16 additions & 0 deletions src/longbow/models/isoseq.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,16 @@
{
"array": {
"description": "PacBio IsoSeq model",
"version": "3.0.0",
"structure": [
"V",
"M"
],
"adapters": {
"V": "TCTACACGACGCTCTTCCGATCT",
"M": "GTACTCTGCGTTGATACCACTGCTT"
},
"deprecated": false,
"name": "isoseq"
}
}
34 changes: 34 additions & 0 deletions src/longbow/models/mas_10.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,34 @@
{
"array": {
"description": "10-element MAS-ISO-seq array",
"version": "3.0.0",
"structure": [
"Q",
"C",
"M",
"I",
"O",
"J",
"B",
"D",
"K",
"H",
"R"
],
"adapters": {
"Q": "AAGCACCATAATGTGT",
"C": "ACTCTGTCAGGTCCGA",
"M": "ACCTAGATCAGAGCCT",
"I": "AGTGCGTTGCGAATTG",
"O": "AAGTCACCGGCACCTT",
"J": "AATTGCGTAGTTGGCC",
"B": "ACTTGTAAGCTGTCTA",
"D": "ACCTCCTCCTCCAGAA",
"K": "ACACTTGGTCGCAATC",
"H": "ATGTTGAATCCTAGCG",
"R": "AACCGGACACACTTAG"
},
"deprecated": false,
"name": "mas_10"
}
}
44 changes: 44 additions & 0 deletions src/longbow/models/mas_15.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,44 @@
{
"array": {
"description": "15-element MAS-ISO-seq array",
"version": "3.0.0",
"structure": [
"A",
"B",
"C",
"D",
"E",
"F",
"G",
"H",
"I",
"J",
"K",
"L",
"M",
"N",
"O",
"P"
],
"adapters": {
"A": "AGCTTACTTGTGAAGA",
"B": "ACTTGTAAGCTGTCTA",
"C": "ACTCTGTCAGGTCCGA",
"D": "ACCTCCTCCTCCAGAA",
"E": "AACCGGACACACTTAG",
"F": "AGAGTCCAATTCGCAG",
"G": "AATCAAGGCTTAACGG",
"H": "ATGTTGAATCCTAGCG",
"I": "AGTGCGTTGCGAATTG",
"J": "AATTGCGTAGTTGGCC",
"K": "ACACTTGGTCGCAATC",
"L": "AGTAAGCCTTCGTGTC",
"M": "ACCTAGATCAGAGCCT",
"N": "AGGTATGCCGGTTAAG",
"O": "AAGTCACCGGCACCTT",
"P": "ATGAAGTGGCTCGAGA"
},
"deprecated": false,
"name": "mas_15"
}
}
46 changes: 46 additions & 0 deletions src/longbow/models/mas_16.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,46 @@
{
"array": {
"description": "16-element MAS-ISO-seq array",
"version": "3.0.0",
"structure": [
"A",
"B",
"C",
"D",
"E",
"F",
"G",
"H",
"I",
"J",
"K",
"L",
"M",
"N",
"O",
"P",
"Q"
],
"adapters": {
"A": "AGCTTACTTGTGAAGA",
"B": "ACTTGTAAGCTGTCTA",
"C": "ACTCTGTCAGGTCCGA",
"D": "ACCTCCTCCTCCAGAA",
"E": "AACCGGACACACTTAG",
"F": "AGAGTCCAATTCGCAG",
"G": "AATCAAGGCTTAACGG",
"H": "ATGTTGAATCCTAGCG",
"I": "AGTGCGTTGCGAATTG",
"J": "AATTGCGTAGTTGGCC",
"K": "ACACTTGGTCGCAATC",
"L": "AGTAAGCCTTCGTGTC",
"M": "ACCTAGATCAGAGCCT",
"N": "AGGTATGCCGGTTAAG",
"O": "AAGTCACCGGCACCTT",
"P": "ATGAAGTGGCTCGAGA",
"Q": "AGTAGCTGTGTGCA"
},
"deprecated": false,
"name": "mas_16"
}
}
61 changes: 61 additions & 0 deletions src/longbow/models/sc_10x3p.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,61 @@
{
"cdna": {
"description": "single-cell 10x 3' kit",
"version": "3.0.0",
"structure": [
"5p_Adapter",
"CBC",
"UMI",
"Poly_T",
"cDNA",
"3p_Adapter"
],
"adapters": {
"5p_Adapter": "TCTACACGACGCTCTTCCGATCT",
"CBC": {
"FixedLengthRandomBases": 16
},
"UMI": {
"FixedLengthRandomBases": 12
},
"Poly_T": {
"HomopolymerRepeat": [
"T",
30
]
},
"cDNA": "random",
"3p_Adapter": "CCCATGTACTCTGCGTTGATACCACTGCTT"
},
"named_random_segments": [
"CBC",
"UMI",
"cDNA"
],
"coding_region": "cDNA",
"annotation_segments": {
"UMI": [
[
"ZU",
"XU"
],
[
"XM",
"XU"
]
],
"CBC": [
[
"CR",
"XB"
],
[
"XC",
"XB"
]
]
},
"deprecated": false,
"name": "sc_10x3p"
}
}
63 changes: 63 additions & 0 deletions src/longbow/models/sc_10x5p.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,63 @@
{
"cdna": {
"description": "single-cell 10x 5' kit",
"version": "3.0.0",
"structure": [
"5p_Adapter",
"CBC",
"UMI",
"SLS",
"cDNA",
"Poly_A",
"3p_Adapter"
],
"adapters": {
"5p_Adapter": "TCTACACGACGCTCTTCCGATCT",
"CBC": {
"FixedLengthRandomBases": 16
},
"UMI": {
"FixedLengthRandomBases": 10
},
"SLS": "TTTCTTATATGGG",
"cDNA": "random",
"Poly_A": {
"HomopolymerRepeat": [
"A",
30
]
},
"3p_Adapter": "GTACTCTGCGTTGATACCACTGCTT"
},
"named_random_segments": [
"CBC",
"UMI",
"cDNA"
],
"coding_region": "cDNA",
"annotation_segments": {
"UMI": [
[
"ZU",
"XU"
],
[
"XM",
"XU"
]
],
"CBC": [
[
"CR",
"XB"
],
[
"XC",
"XB"
]
]
},
"deprecated": false,
"name": "sc_10x5p"
}
}
Loading