AltSplice insertion with another frameshift variant closed to the end of the subgraph end

[zhuchcn]

When there is a frameshift variant in the inserted sequence of a altSplice, and if it's very close to the subgraph end, it may cause the graph being broken under certain circumstances. In the figure below, in reading frame 0 (top), the node GTGTATCCTTTAAATCATTACTCAAGAATCATTTGAAAAGATAGTTCCAG has an altSplice insertion, which shifts to reading frame 1. The node AAAATGA has an intronic frameshift variant that makes it go back to reading frame 0. This node should be recognized as an end of the subgraph.

See example below, when the node GTA is detached from the graph.